miRBase entry: mdo-mir-27b

Stem-loop mdo-mir-27b


Accession
MI0005367
Description
Monodelphis domestica mdo-mir-27b precursor miRNA


Sequence

171470 reads, 2688 reads per million, 5 experiments
accucucugacaaggugcAGAGCUUAGCCGAUUGGUGAACAgucacugauuuccucuuugUUCACAGUGGCUAAGUUCUGCaccugaagagaagggg
.(((((((....((((((((((((((((((....((((((((...............))))))))..))))))))))))))))))..)))).)))..

Structure
-a   -    gaca                  AUUG        ucacug 
  ccu cucu    aggugcAGAGCUUAGCCG    GUGAACAg      a
  ||| ||||    ||||||||||||||||||    ||||||||      u
  gga gaga    uccaCGUCUUGAAUCGGU    CACUUguu      u
gg   a    --ag                  --GA        ucuccu 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr6: 17696090-17696186 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from mdo-mir-27b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mdo-miR-27b-3p

Accession MIMAT0004177
Description Monodelphis domestica mdo-miR-27b-3p mature miRNA
Sequence 61 - UUCACAGUGGCUAAGUUCUGC - 81
Evidence experimental
Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

Mature mdo-miR-27b-5p

Accession MIMAT0026714
Description Monodelphis domestica mdo-miR-27b-5p mature miRNA
Sequence 19 - AGAGCUUAGCCGAUUGGUGAACA - 41
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 17965199
    In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica
    "Devor EJ, Samollow PB"
    "J Hered (2008) 99:66-72

  2. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45