miRBase entry: mdo-mir-93

Stem-loop mdo-mir-93


Accession
MI0005369
Description
Monodelphis domestica mdo-mir-93 precursor miRNA


Sequence

10139 reads, 166 reads per million, 5 experiments
agucuuggggggcuccAAAGUGCUGUUCGUGCAGGUAGugugauaaccugaccuACUGCUGAGCUAGCACUUCCAGagccccugggaca
.((((..((((((((..((((((((((((.((((.(((.((.(.....).)))))))))))))).)))))))...)))))))).)))).

Structure
a    ug        -cA       -     U    G   u  g u 
 gucu  gggggcuc   AAGUGCU GUUCG GCAG UAG gu a a
 ||||  ||||||||   ||||||| ||||| |||| ||| || | a
 cagg  uccccgaG   UUCACGA CGAGU CGUC Auc ca u c
a    -g        ACC       U     -    -   -  g c 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr2: 257689983-257690071 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mdo-mir-93
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mdo-miR-93-5p

Accession MIMAT0004178
Description Monodelphis domestica mdo-miR-93-5p mature miRNA
Sequence 17 - AAAGUGCUGUUCGUGCAGGUAG - 38
Evidence experimental
Microarray [1], PCR [1], Illumina [2]

Mature mdo-miR-93-3p

Accession MIMAT0026715
Description Monodelphis domestica mdo-miR-93-3p mature miRNA
Sequence 55 - ACUGCUGAGCUAGCACUUCCAG - 76
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 17965199
    In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica
    "Devor EJ, Samollow PB"
    "J Hered (2008) 99:66-72

  2. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45