MIR885 is a miRNA that has been implicated in various biological processes and diseases. It is a negative regulator of autophagy and has been shown to target genes involved in autophagy, such as ULK1, BECN1, RAB5A, and RB1CC1 [PMC4990999]. In addition, MIR885 has been found to be downregulated in sFRP4 SI cells and upregulated in sFRP4 OE treated cells [PMC6356444]. It has also been shown to be upregulated in CRC cell lines and stimulates migration while downregulating IGFBP-5 [PMC9203274]. MIR885 can suppress ISRE activities induced by IFN-α stimulation [PMC3434395]. Furthermore, MIR885 is involved in the interplay with p73ΔEx2/3 to enhance stemness and self-renewal capacity in less invasive melanoma cells [PMC7765507]. Differential methylation of CG dinucleotides in the promoter regions of MIR885 has also been reported, which might influence its expression [PMC9847511]. Moreover, MIR885 has been implicated as a tumor suppressor miRNA that targets CD276 (B7-H3) and IGFR [PMC4697439] [PMC8506118]. Overall, these findings highlight the diverse roles of MIR885 in various biological processes and its potential as a therapeutic target.
-- ca c A - cu ccg cucu UCCAUUACACU CC CUGCCUCUu c ||| |||| ||||||||||| || ||||||||| ggc gagA AGGUGAUGUGG GG GACGGAgag c ug ac U - C ua
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004947 |
Description | Homo sapiens hsa-miR-885-5p mature miRNA |
Sequence | 11 - UCCAUUACACUACCCUGCCUCU - 32 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0004948 |
Description | Homo sapiens hsa-miR-885-3p mature miRNA |
Sequence | 43 - AGGCAGCGGGGUGUAGUGGAUA - 64 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|