| Accession | MIMAT0004948 | 
| Description | hsa-miR-885-3p mature miRNA | 
| Hairpins | |
| Sequence | AGGCAGCGGGGUGUAGUGGAUA | 
| Evidence | 
                    experimental
                    
                     cloned [2]  | 
            
| Database links | 
                                    
                                                
                                                     
                                   
                                   
                                   
                                    
                                        
                                   
                                   
                                    
                                        
                                  
                                 | 
| Predicted targets | 
                                        
                                          
                                        
                                          
                                            
                                                
                                                     
                                                
                                            
                                          
                                        
                                          
                                            
                                                
                                                     
                                                
                                            
                                          
                                        
                                          
                                            
                                                
                                                     
                                                
                                            
                                          
                                        
                                
                               
                             
                                
                             
                                
                             
                                
                             
                           | 
                       
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study | 
|---|