WARNING: This summary was generated by AI. MIR374B, a microRNA, exhibits differential expression patterns in various cell types and disease states. In naïve mesenchymal stem cells (MSCs), MIR374B expression is significantly higher compared to primed MSCs [PMC9509608]. It is implicated in the regulation of chemokines such as Cxcl1, Ccl2, and Ccl7, which may influence the development of AMA by targeting these molecules [PMC5712098]. MIR374B overexpression in B cells within the Chinese population has been linked to increased B-cell proliferation and altered IgA1 galactosylation [PMC6834307]. It also plays a role in cancer by targeting PD-1 to modulate T cell function [PMC6833224]. In vascular tissues, MIR374B levels vary with low expression at atheroprotected sites and higher expression at atheroprone regions within endothelial cells [PMC6590197]. Downregulation of MIR374B has been associated with the P-phase of cell cycle regulation [PMC7376782], and its increased levels have been correlated with improved survival outcomes in cancer patients treated with regorafenib [PMC9589420]. Furthermore, MIR374B targets genes such as RECK and ZEB2 to inhibit cellular migration and invasion in bladder cancer [PMC7783806]'>PMC7783806], while its differential methylation patterns have been observed in warts compared to normal skin [PMC7783806]. Lastly, ethnicity may influence MIR374B expression levels as seen in skin samples from Han Chinese individuals compared to Uyghurs [PMC7783806].
-- u AU c ac cggaugg AUAAUACAACCUGCUAAGUGu c || ||||||| ||||||||||||||||||||| ug gccugUU UAUUAUGUUGGACGAUUCacg u uc u AC a
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004955 |
| Description | Homo sapiens hsa-miR-374b-5p mature miRNA |
| Sequence | 11 - AUAUAAUACAACCUGCUAAGUG - 32 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004956 |
| Description | Homo sapiens hsa-miR-374b-3p mature miRNA |
| Sequence | 41 - CUUAGCAGGUUGUAUUAUCAUU - 62 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|