Stem-loop ppt-MIR477c

Accession

MI0005671

Description

Physcomitrella patens ppt-MIR477c precursor miRNA

Literature search

1 open access papers mention ppt-MIR477c
(11 sentences)

Sequence

guugauuuuucCUCUCCCUCAAAGGCUUCCAacguccuuuuugugagcaagcacgcuggaagucuuuguugaagaggaggaaaca
..((.((((((((((.(..((((((((((((.(((.(((.........))).))).))))))))))))..).)))))))))).))

Structure

gu  a          C CU            a   c   uuu 
  ug uuuuucCUCU C  CAAAGGCUUCCA cgu cuu   g
  || |||||||||| |  |||||||||||| ||| |||   u
  ac aaggaggaga g  guuucugaaggu gca gaa   g
--  a          a uu            c   c   cga 

Annotation confidence Not enough data

Comments

This sequence was named miR473a in [1]. The miR477 family contains miRNAs previously called miR473, miR1210 and miR1213 here. The names and sequences are rationalised in [2]. The mature sequence shown here is the most abundant clone by deep-sequencing [2].

Genome context

Chr25: 5057729-5057813 [-]

Mature ppt-miR477c

• Accession: MIMAT0004359
• Description: Physcomitrella patens ppt-miR477c mature miRNA
• Sequence: 12 - CUCUCCCUCAAAGGCUUCCA - 31
• Evidence: experimental ; Northern [1], 454 [2], cloned [2]

References

1. PubMed ID: 17359535
   Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution
   Fattash I, Voss B, Reski R, Hess WR, Frank W
   BMC Plant Biol (2007) 7:13


2. PubMed ID: 17601824
   Common functions for diverse small RNAs of land plants
   "Axtell MJ, Snyder JA, Bartel DP"
   "Plant Cell (2007) 19:1750-1769