MIR934 is a microRNA whose single nucleotide polymorphism (SNP) at position n.15T>G in the 1st nucleotide in the 5p strand affects the cleavage sites of DROSHA/DICER1, leading to the production of a novel isomiR [PMC9708458]. This alteration was validated through luciferase assays, which confirmed the interaction between MIR934 and its target genes TFCP2L1 and RAB3B [PMC7295570]. In silico analysis and luciferase assays further identified MIR934 binding sites on the 3'-UTR of FZD5, TFCP2L1, and RAB3B, with varying degrees of conservation across species [PMC7295570]. Specifically, MIR934 was shown to bind at certain sites on these mRNAs in HEK293T cells [PMC7295570]. Additionally, research on colorectal cancer (CRC) cells demonstrated that knockdown of miR-934 affects cell proliferation and cell cycle by transfecting cells with a MIR934 inhibitor [PMC8809948]. The expression levels of circRNF10 and MIR934 were quantified using specific primers to further understand their relationship in CRC [PMC9739140].
C A uagu
agaaauaaggcuucUGUCUA UACUGGAGAC CUGG a
|||||||||||||||||||| |||||||||| |||| u
ucuuuauuccgagggcaggu augaccucug gacc a
a a caaa
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004977 |
| Description | Homo sapiens hsa-miR-934 mature miRNA |
| Sequence | 15 - UGUCUACUACUGGAGACACUGG - 36 |
| Evidence |
experimental
cloned [1] |
| Database links |
|
| Predicted targets |
|
|