miRBase entry: hsa-mir-940

Stem-loop hsa-mir-940


Accession
MI0005762
Symbol
HGNC: MIR940
Description
Homo sapiens hsa-mir-940 precursor miRNA mir-940
Gene
family?
RF01023; mir-940

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR940 is a microRNA implicated in various cancer-related processes, including tumor progression and metastasis [PMC7072613]. It has been identified as a potential diagnostic biomarker for nasopharyngeal carcinoma (NPC) due to its high sensitivity and specificity [PMC7534087], [PMC6700302]. Research has shown that MIR940, along with other miRNAs, is involved in the regulation of gene expression by binding to the 3’-UTR of target mRNAs, influencing tumor cell viability and invasion [PMC6433657]. In the context of NPC, MIR940 has been highlighted for its diagnostic potential in plasma microarray data analyses [PMC7534087], [PMC6700302]. Additionally, MIR940 is involved in the regulation of osteogenesis in mesenchymal stem cells (MSCs) and has been studied for its role in promoting M2 phenotype polarization when expressed in exosomes from ovarian epithelial carcinoma cells [PMC7072613], [PMC8346509]. Furthermore, it is up-regulated in gastric cancer and contributes to cancer cell migration and invasion by targeting the tumor suppressor gene ZNF24 [PMC4944467]. These findings suggest that MIR940 could serve as a target for therapeutic intervention as well as a biomarker for various cancers.

Literature search
36 open access papers mention hsa-mir-940
(333 sentences)

Sequence

3259 reads, 20 reads per million, 80 experiments
gugaggugugggcccggccccaggagcggggccugggcagccccguguguugaggaaggAAGGCAGGGCCCCCGCUCCCCgggccugaccccac
(((.(((..((((((((.....((((((((((((.(.(..((((.........))..))..).).))).))))))))))))))))).))).)))

Structure
   a   gu        cccca         -   g g ag  --  gug 
gug ggu  gggcccgg     ggagcgggg ccu g c  cc  cc   u
||| |||  ||||||||     ||||||||| ||| | |  ||  ||   g
cac cca  uccgggCC     CCUCGCCCC GGG C G  gg  gg   u
   c   -g        -----         C   A G AA  aa  agu 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr16: 2271747-2271840 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-940
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-940 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-940

Accession MIMAT0004983
Description Homo sapiens hsa-miR-940 mature miRNA
Sequence 60 - AAGGCAGGGCCCCCGCUCCCC - 80
Evidence experimental
cloned [1]
Database links
Predicted targets

References

  1. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043