MIR942 is a microRNA molecule that has been studied in various contexts. In blood platelets from patients with NSTEMI, it was found to be one of the most downregulated miRNAs [PMC5155104]. In ovarian cancer, the circular RNA CircEPSTI1 was found to promote cancer progression by inhibiting MIR942 [PMC7479240]. Additionally, upregulation of MIR942 has been associated with sunitinib resistance in patients with metastatic renal cell carcinoma [PMC6917607]. However, there is limited research on MIR942 in the context of ADHD, with only one study found [PMC8077053]. In a different study, two consecutive probes downstream of a top 20 probe for MIR942 reached a significant threshold and were differentially methylated CpGs [PMC9922242]. Furthermore, in two studies based on the GSE94462 dataset, MIR942 was among several microRNAs that were analyzed [PMC9922242]. In another study on obstructive sleep apnea (OSA), the expression of KCNN2 and MIR942 significantly increased as OSA progressed and significantly decreased after treatment [PMC9554663]. Additionally, the expression of KCNN2 and other genes such as PLXNB3 and SERPINA12 were positively correlated with apnea-hypopnea index (AHI) in OSA patients [PMC9554663]. Overall, these studies highlight the potential role of MIR942 in various diseases and conditions.
U uacuca auuaggagagua CUUCUCUGUUUUGGCCAUGUGug c |||||||||||| ||||||||||||||||||||||| uaauccuuucau GAAGAGACAAAGCCGGUACACac a U uccccg
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004985 |
Description | Homo sapiens hsa-miR-942-5p mature miRNA |
Sequence | 13 - UCUUCUCUGUUUUGGCCAUGUG - 34 |
Evidence |
experimental
cloned [1], Illumina [2] |
Database links | |
Predicted targets |
Accession | MIMAT0026734 |
Description | Homo sapiens hsa-miR-942-3p mature miRNA |
Sequence | 53 - CACAUGGCCGAAACAGAGAAGU - 74 |
Evidence |
experimental
Illumina [2] |
Database links | |
Predicted targets |
|