miRBase entry: hsa-mir-1291

Stem-loop hsa-mir-1291


Accession
MI0006353
Symbol
HGNC: MIR1291
Description
Homo sapiens hsa-mir-1291 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1291 is a microRNA that has been identified as a target gene for Rho GTPase activating protein 29 (ArhGAP29) [PMC5647010]. It has been found to be downregulated in various conditions, including in Cluster 2 snoRNA transcripts [PMC8225861]. In TamR cells, MIR1291 is slightly upregulated with moderate absolute expression levels [PMC3402532]. In breast, RCC, and T24 cells, MIR1291 has been associated with GLUT1 and GLUT3 [PMC9663470]. In exhaled breath condensates from COPD and asthma patients, MIR1291 is downregulated specifically in asthmatic patients [PMC8196952]. Furthermore, MIR1291 is one of the top 10 miRNAs that are upregulated after IFN-γ stimulation [PMC8010072].

MIR1291 is a microRNA that has been extensively studied in various contexts. It has been identified as a target gene for ArhGAP29 and found to be downregulated in certain conditions. Additionally, it has been associated with GLUT transporters and shown to have differential expression patterns in COPD and asthma patients. Furthermore, it is one of the miRNAs that are upregulated after IFN-γ stimulation. These findings highlight the potential role of MIR1291 in various biological processes and its potential as a therapeutic target.

References:
- [PMC5647010]
- [PMC8225861]
- [PMC3402532]
- [PMC9663470]
- [PMC8196952]
- [PMC8010072]

Literature search
11 open access papers mention hsa-mir-1291
(126 sentences)

Sequence

1381 reads, 203 reads per million, 74 experiments
gguagaauuccagUGGCCCUGACUGAAGACCAGCAGUuguacuguggcuguugguuucaagcagaggccuaaaggacugucuuccug
((.(((..(((...(((((((.((..((((((((((((.......))))))))))))..))))).))))....)))...))).))..

Structure
--  u   -au   -agU    -   A  GA            gu 
  gg aga   ucc    GGCC CUG CU  AGACCAGCAGUu  a
  || |||   |||    |||| ||| ||  ||||||||||||  c
  cc ucu   agg    ccgg gac ga  uuugguugucgg  u
gu  u   guc   aaau    a   -  ac            ug 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr12: 48654444-48654530 [-]

Disease association
hsa-mir-1291 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1291

Accession MIMAT0005881
Description Homo sapiens hsa-miR-1291 mature miRNA
Sequence 14 - UGGCCCUGACUGAAGACCAGCAGU - 37
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621