MIR1291 is a microRNA that has been identified as a target gene for Rho GTPase activating protein 29 (ArhGAP29) [PMC5647010]. It has been found to be downregulated in various conditions, including in Cluster 2 snoRNA transcripts [PMC8225861]. In TamR cells, MIR1291 is slightly upregulated with moderate absolute expression levels [PMC3402532]. In breast, RCC, and T24 cells, MIR1291 has been associated with GLUT1 and GLUT3 [PMC9663470]. In exhaled breath condensates from COPD and asthma patients, MIR1291 is downregulated specifically in asthmatic patients [PMC8196952]. Furthermore, MIR1291 is one of the top 10 miRNAs that are upregulated after IFN-γ stimulation [PMC8010072]. MIR1291 is a microRNA that has been extensively studied in various contexts. It has been identified as a target gene for ArhGAP29 and found to be downregulated in certain conditions. Additionally, it has been associated with GLUT transporters and shown to have differential expression patterns in COPD and asthma patients. Furthermore, it is one of the miRNAs that are upregulated after IFN-γ stimulation. These findings highlight the potential role of MIR1291 in various biological processes and its potential as a therapeutic target. References: - [PMC5647010] - [PMC8225861] - [PMC3402532] - [PMC9663470] - [PMC8196952] - [PMC8010072]
-- u -au -agU - A GA gu gg aga ucc GGCC CUG CU AGACCAGCAGUu a || ||| ||| |||| ||| || |||||||||||| c cc ucu agg ccgg gac ga uuugguugucgg u gu u guc aaau a - ac ug
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005881 |
Description | Homo sapiens hsa-miR-1291 mature miRNA |
Sequence | 14 - UGGCCCUGACUGAAGACCAGCAGU - 37 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|