WARNING: This summary was generated by AI. MIR548K is a microRNA implicated as a novel oncogene in esophageal squamous cell carcinomas (ESCC), encoded in the 11q13.3–13.4 region, which is frequently amplified in these tumors [PMC5294420]. This microRNA has been associated with enhanced cell proliferation in ESCC cell lines and lies within a region of chromosomal gain that includes other known oncogenes [PMC7137242]. In a South African cohort, MIR548K amplification was observed in 12 out of 51 cases, suggesting its potential role as a key gene [PMC7137242]. Furthermore, MIR548K overexpression has been linked to increased sensitivity to the chemotherapeutic agent PD-0325901 and has been proposed as a target for chemoprevention [PMC5094973]. Depletion of MIR548K results in suppressed cellular growth and mobility, indicating its functional importance in tumor biology [PMC5094973]. Additionally, amplification of MIR548K correlates with poor survival outcomes for ESCC patients and is significantly associated with lymphatic metastasis, highlighting its potential as a prognostic marker and therapeutic target [PMC6103855].
cuuuucucaa c u C A uuac
guauug uguuagguugg gcAAAAGUA UUGCGG UUUUGCU u
|||||| ||||||||||| ||||||||| |||||| ||||||| u
cguagu auaauccaacu CGUUUUUAU AACGCC AAAACgg u
ucgguuaaaa - U U A uaau
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005882 |
| Description | Homo sapiens hsa-miR-548k-5p mature miRNA |
| Sequence | 32 - AAAAGUACUUGCGGAUUUUGCU - 53 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0050525 |
| Description | Homo sapiens hsa-miR-548k-3p mature miRNA |
| Sequence | 67 - CAAAAACCGCAAUUAUUUUUGCU - 89 |
| Evidence |
experimental
Illumina [1] |
|