Stem-loop hsa-mir-548k

Accession

MI0006354

Symbol

HGNC: MIR548K

Description

Homo sapiens hsa-mir-548k precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR548K is a microRNA that has been shown to enhance cell proliferation in esophageal squamous cell carcinoma (ESCC) cell lines [PMC7137242]. It is located within the broader region of gain on chromosome 11q13, which is amplified in ESCC [PMC7137242]. In a South African cohort, 12 out of 51 cases had a broader region of gain on chromosome 11q13.3, which included MIR548K as well as other known oncogenes [PMC7137242]. MIR548K has been characterized as a novel oncogene that enhances malignant phenotypes of ESCC cells [PMC5294420]. Higher copy numbers of MIR548K have been found in sensitive cell lines to the drug PD-0325901 [PMC5094973]. Targeting MIR548K may be relevant for chemoprevention of tumors within the same cancerization field [PMC5094973]. Depletion of MIR548K has been shown to suppress cellular growth and mobility, although its targets have not been reported [PMC5094973]. Amplification and copy number alterations of MIR548K have been associated with lymphatic metastasis and poor survival outcomes in ESCC patients [PMC6103855]. The most frequent alteration genes associated with lymph node metastasis were MIR548K, FADD, PPFIA1, CTTN, and CDKN2A, all located within the 11q13.3 amplicon [PMC6103855]. In conclusion, MIR548K is an oncogenic microRNA that plays a role in ESCC progression and may be a potential therapeutic target for this disease.

Literature search

42 open access papers mention hsa-mir-548k
(149 sentences)

Sequence

6021 reads, 129 reads per million, 75 experiments

cuuuucucaaguauugcuguuagguuggugcAAAAGUACUUGCGGAUUUUGCUuuacuuuuaauggcaaaaaccgcaauuauuuuugcuucaaccuaauaugaugcaaaauuggcu
..........((((((.(((((((((((.(((((((((.((((((.(((((((...........))))))).)))))).))))))))).)))))))))))))))))..........

Structure

cuuuucucaa      c           u         C      A       uuac 
          guauug uguuagguugg gcAAAAGUA UUGCGG UUUUGCU    u
          |||||| ||||||||||| ||||||||| |||||| |||||||    u
          cguagu auaauccaacu cguuuuuau aacgcc aaaacgg    u
ucgguuaaaa      -           u         u      a       uaau 

Annotation confidence Not enough data

Genome context

chr11: 70283955-70284070 [+]

Disease association

hsa-mir-548k is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-548k

• Accession: MIMAT0005882
• Description: Homo sapiens hsa-miR-548k mature miRNA
• Sequence: 32 - AAAAGUACUUGCGGAUUUUGCU - 53
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 18285502
   Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
   "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
   "Genome Res (2008) 18:610-621