miRBase entry: hsa-mir-548k

Stem-loop hsa-mir-548k


Accession
MI0006354
Symbol
HGNC: MIR548K
Description
Homo sapiens hsa-mir-548k precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR548K is a microRNA that has been shown to enhance cell proliferation in esophageal squamous cell carcinoma (ESCC) cell lines [PMC7137242]. It is located within the broader region of gain on chromosome 11q13, which is amplified in ESCC [PMC7137242]. In a South African cohort, 12 out of 51 cases had a broader region of gain on chromosome 11q13.3, which included MIR548K as well as other known oncogenes [PMC7137242]. MIR548K has been characterized as a novel oncogene that enhances malignant phenotypes of ESCC cells [PMC5294420]. Higher copy numbers of MIR548K have been found in sensitive cell lines to the drug PD-0325901 [PMC5094973]. Targeting MIR548K may be relevant for chemoprevention of tumors within the same cancerization field [PMC5094973]. Depletion of MIR548K has been shown to suppress cellular growth and mobility, although its targets have not been reported [PMC5094973]. Amplification and copy number alterations of MIR548K have been associated with lymphatic metastasis and poor survival outcomes in ESCC patients [PMC6103855]. The most frequent alteration genes associated with lymph node metastasis were MIR548K, FADD, PPFIA1, CTTN, and CDKN2A, all located within the 11q13.3 amplicon [PMC6103855]. In conclusion, MIR548K is an oncogenic microRNA that plays a role in ESCC progression and may be a potential therapeutic target for this disease.

Literature search
42 open access papers mention hsa-mir-548k
(149 sentences)

Sequence

6021 reads, 129 reads per million, 75 experiments
cuuuucucaaguauugcuguuagguuggugcAAAAGUACUUGCGGAUUUUGCUuuacuuuuaauggcaaaaaccgcaauuauuuuugcuucaaccuaauaugaugcaaaauuggcu
..........((((((.(((((((((((.(((((((((.((((((.(((((((...........))))))).)))))).))))))))).)))))))))))))))))..........

Structure
cuuuucucaa      c           u         C      A       uuac 
          guauug uguuagguugg gcAAAAGUA UUGCGG UUUUGCU    u
          |||||| ||||||||||| ||||||||| |||||| |||||||    u
          cguagu auaauccaacu cguuuuuau aacgcc aaaacgg    u
ucgguuaaaa      -           u         u      a       uaau 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr11: 70283955-70284070 [+]

Disease association
hsa-mir-548k is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-548k

Accession MIMAT0005882
Description Homo sapiens hsa-miR-548k mature miRNA
Sequence 32 - AAAAGUACUUGCGGAUUUUGCU - 53
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621