MIR548K is a microRNA that has been shown to enhance cell proliferation in esophageal squamous cell carcinoma (ESCC) cell lines [PMC7137242]. It is located within the broader region of gain on chromosome 11q13, which is amplified in ESCC [PMC7137242]. In a South African cohort, 12 out of 51 cases had a broader region of gain on chromosome 11q13.3, which included MIR548K as well as other known oncogenes [PMC7137242]. MIR548K has been characterized as a novel oncogene that enhances malignant phenotypes of ESCC cells [PMC5294420]. Higher copy numbers of MIR548K have been found in sensitive cell lines to the drug PD-0325901 [PMC5094973]. Targeting MIR548K may be relevant for chemoprevention of tumors within the same cancerization field [PMC5094973]. Depletion of MIR548K has been shown to suppress cellular growth and mobility, although its targets have not been reported [PMC5094973]. Amplification and copy number alterations of MIR548K have been associated with lymphatic metastasis and poor survival outcomes in ESCC patients [PMC6103855]. The most frequent alteration genes associated with lymph node metastasis were MIR548K, FADD, PPFIA1, CTTN, and CDKN2A, all located within the 11q13.3 amplicon [PMC6103855]. In conclusion, MIR548K is an oncogenic microRNA that plays a role in ESCC progression and may be a potential therapeutic target for this disease.
cuuuucucaa c u C A uuac guauug uguuagguugg gcAAAAGUA UUGCGG UUUUGCU u |||||| ||||||||||| ||||||||| |||||| ||||||| u cguagu auaauccaacu cguuuuuau aacgcc aaaacgg u ucgguuaaaa - u u a uaau
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005882 |
Description | Homo sapiens hsa-miR-548k mature miRNA |
Sequence | 32 - AAAAGUACUUGCGGAUUUUGCU - 53 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|