MIR1293 is a microRNA that has been studied in the context of lung adenocarcinoma (LUAD). Univariate Cox regression analysis has shown that high expression of MIR1293 is associated with poor survival outcomes in LUAD [PMC7212445]. In contrast, high expression of LINC01740, another gene in the ceRNA network, is associated with good survival outcomes [PMC7212445]. In a combined step regression and Cox regression analysis, MIR1293 was identified as one of four genes that serve as prognostic biomarkers in LUAD [PMC7212445]. Furthermore, MIR1293 was found to be a novel important prognostic factor involved in LUAD pathogenesis [PMC7212445]. In a study comparing expression levels between high-risk and low-risk groups, it was observed that the expression level of MIR1293 was higher in the high-risk group [PMC7212445]. Additionally, MIR1293 has been shown to be involved in the regulation of vIL-6 and hIL-6 through binding sites in their open reading frames (ORF) [PMC9495386]. Expression deregulation patterns of several miRNAs, including MIR1293, have been observed in leukoplakia and leukoplakia-transformed cancer tissues [PMC5011738]. References: - [PMC7212445]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7212445/ - [PMC9495386]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9495386/ - [PMC5011738]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5011738/
agguuguu cu cUGGGUGGUCUGGAGAUUUGUGCag u ||||||||||||||||||||||||| g gauucaccaggccucuaaacacguc u --auuucu ca
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005883 |
Description | Homo sapiens hsa-miR-1293 mature miRNA |
Sequence | 10 - UGGGUGGUCUGGAGAUUUGUGC - 31 |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
|