MIR1305 is a microRNA that has been implicated in various biological processes and diseases. In a study, it was found that overexpression of circCOG2, a circular RNA, led to pro-EMT (epithelial-mesenchymal transition) and activation of TGF-β2. However, this effect was rescued by miR-1305 overexpression, which resulted in the upregulation of E-cadherin and downregulation of vimentin, TGF-β2, SMAD3, and p-SMAD3 [PMC8505430]. In ovarian cancer patients with a shallow deletion of MIR1305 and high DIRAS3 expression (a tumor suppressor gene), better overall survival was observed compared to patients with no alteration in MIR1305 copy number variation [PMC9101105]. MIR1305 has also been implicated in the regulation of osteogenic differentiation [PMC8503254]. Furthermore, it was found that MIR1305 expression is induced by atRA exposure [PMC4168020]. However, there is currently no report linking MIR1305 to RIF (recurrent implantation failure) or its association with upstream circRNA [PMC7924221]. Additionally, the inhibition of NUCKS1 affects changes in the expression of several microRNAs including miR4796, MIR1305, miR4762, and miR4445 [PMC5830027]. These findings highlight the diverse roles and potential clinical relevance of MIR1305 in various biological processes and diseases.
--aa a uu uguu g gauccugcuguuucu ccauuag uugaa uauu u ||||||||||||||| ||||||| ||||| |||| a uuaggacgacAGAGA GGUAAUC AACUU auag a ccuc G UC -UUc a
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005893 |
Description | Homo sapiens hsa-miR-1305 mature miRNA |
Sequence | 51 - UUUUCAACUCUAAUGGGAGAGA - 72 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|