WARNING: This summary was generated by AI. MIR1305 is a microRNA implicated in various cellular processes and clinical outcomes, particularly in cancer biology. Overexpression of circCOG2, a circular RNA, and its rescue by MIR1305 mimics resulted in the modulation of epithelial-mesenchymal transition (EMT) markers and TGF-β2 signaling pathway components, indicating a regulatory role of MIR1305 in these processes [PMC8505430]. In ovarian cancer, patients with a shallow deletion of MIR1305 and concurrent upregulation of DIRAS3 mRNA exhibited longer overall survival [PMC9101105]. This correlation was further supported by bioinformatic analysis showing that high DIRAS3 expression along with MIR1305 downregulation is associated with better clinical outcomes [PMC9101105]. Additionally, the expression levels of MIR1305 were found to be inversely correlated with DIRAS3 mRNA levels [PMC9101105]. In the context of osteogenic differentiation in periodontal ligament stem cells (PDLSCs), MIR1305 has been reported to be among the microRNAs that regulate this process [PMC8503254]. Furthermore, differentiation was found to suppress certain microRNAs including MIR1305 [PMC4168020]'>PMC4168020], while exposure to all-trans retinoic acid (atRA) induced its expression along with other miRNAs [PMC4168020]. Despite these findings, no direct link has been reported between MIR1305 and reproductive implantation failure (RIF) or its association with upstream circRNA [PMC7924221], indicating potential areas for future research.
--aa a uu uguu g
gauccugcuguuucu ccauuag uugaa uauu u
||||||||||||||| ||||||| ||||| |||| a
uuaggacgacAGAGA GGUAAUC AACUU auag a
ccuc G UC -UUc a
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005893 |
| Description | Homo sapiens hsa-miR-1305 mature miRNA |
| Sequence | 51 - UUUUCAACUCUAAUGGGAGAGA - 72 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|