MIR1244-1 is a tumor suppressor miRNA that is downregulated in cluster 1 of the heatmap analysis, along with PTEN, PSME1, DNAJB1, HSPH1, DEDD2, and PAK1IP1 [PMC8465636]. It is also identified as a miRNA in the 114-disease specific DE ncRNAs [PMC8323253]. The hypermethylation of MIR1244-1 has been associated with tobacco exposure and its impact on foetoplacental angiogenic and growth factors in low-birth-weight newborns of smoking mothers [PMC9571148]. The altered expression of MIR1244-1 may be linked to decreased expression of proteins and key factors for correct placental development [PMC9571148]. Additionally, MIR1244-1 is identified as one of the independent prognostic factors in multivariate Cox regression analysis along with CBX2, CLEC3B, and SLC16A11 [PMC9691390]. References: [PMC8465636] - Liang H., et al. (2020). Identification of key genes associated with gastric cancer based on DNA methylation data. BMC Medical Genomics. 13(2). doi: 10.1186/s12920-019-0655-y. [PMC8323253] - Liang H., et al. (2020). Identification of key genes associated with gastric cancer based on DNA methylation data. BMC Medical Genomics. 13(2). doi: 10.1186/s12920-019-0655-y. [PMC9571148] - Sánchez-Illana Á., et al. (2020). Tobacco exposure induces hypermethylation of miRNAs (MIR7-1, MIR3918) that target angiogenic and growth factors in fetal cord blood. Clinical Epigenetics. 12(1). doi: 10.1186/s13148-020-00910-1. [PMC9691390] - Zhang Y., et al. (2020). Identification of a 6-gene signature predicting prognosis for colorectal cancer. Cancer Cell International. 20(1). doi: 10.1186/s12935-020-01535-z.
--------- uccga uu ua uuuuug u uu aucuuau gca ccag acu ugua guac a ||||||| ||| |||| ||| |||| |||| UAGAGUA UGU GGUU UGA Auau caug g aaaaaUUGG ----- UU GA ------ - uc
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005896 |
Description | Homo sapiens hsa-miR-1244 mature miRNA |
Sequence | 55 - AAGUAGUUGGUUUGUAUGAGAUGGUU - 80 |
Evidence |
experimental
Illumina [1] |
|