MIR1247 is a microRNA that has been observed to be densely present in primary gastric cancer tissues, in contrast to normal gastric tissues [PMC9476644]. This microRNA, along with mir941, is subject to silencing by DNA methylation in various gastric cancer cell lines [PMC9476644]. The regulation of MIR1247 by DNA methylation has been linked to the inhibition of oncogenes, thereby potentially suppressing the progression of gastric cancer [PMC9476644]. However, MIR1247 expression was not found to be elevated in tumor tissues when compared with adjacent non-tumor tissues [PMC7590111]. The inhibition of MIR1247 was shown to decrease cell viability in cancer cell lines, indicating its role in tumor cell survival [PMC7590111]. Moreover, MIR1247 was not active across the tested cell lines when used as an extra control [PMC8602334]. The gene PCNXL3 has a significant correlation with colon adenocarcinoma and is listed among genes including MIR1247 that are associated with hyper-methylated regions in cancer compared to control samples [PMC5986643]. Furthermore, the regulation of MIR1247 has been associated with the growth and migration of gastric cancer cells [PMC7541134], and its expression is highly regulated across various diseases including diabetes and different types of malignancies [PMC5114726; PMC5966945].. Notably, an increase in miR-1247 expression was observed following treatment that reduced methylation levels of MIR1247 [PMC6251029].
c u - ---c a c cccc - --c A C C UU C Ac ugc cgcu gc cucg cc gcg ag ggc cg ugggcgc CC GUC CG CGU CCCGG gu u |||| || |||| || ||| || ||| || ||||||| || ||| || ||| ||||| || gcgg cg gagc gg cgc uc ccg gu gcccgCG GG CAG GC GCA GGGCC Ca c - - a ccca - u --ca a caa A U A -U A -C ucu
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005899 |
| Description | Homo sapiens hsa-miR-1247-5p mature miRNA |
| Sequence | 40 - ACCCGUCCCGUUCGUCCCCGGA - 61 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0022721 |
| Description | Homo sapiens hsa-miR-1247-3p mature miRNA |
| Sequence | 74 - CCCCGGGAACGUCGAGACUGGAGC - 97 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
|