miRBase entry: hsa-mir-1247

Stem-loop hsa-mir-1247


Accession
MI0006382
Symbol
HGNC: MIR1247
Description
Homo sapiens hsa-mir-1247 precursor miRNA mir-1247
Gene
family?
RF03271; mir-1247

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1247 is a microRNA that has been observed to be densely present in primary gastric cancer tissues, in contrast to normal gastric tissues [PMC9476644]. This microRNA, along with mir941, is subject to silencing by DNA methylation in various gastric cancer cell lines [PMC9476644]. The regulation of MIR1247 by DNA methylation has been linked to the inhibition of oncogenes, thereby potentially suppressing the progression of gastric cancer [PMC9476644]. However, MIR1247 expression was not found to be elevated in tumor tissues when compared with adjacent non-tumor tissues [PMC7590111]. The inhibition of MIR1247 was shown to decrease cell viability in cancer cell lines, indicating its role in tumor cell survival [PMC7590111]. Moreover, MIR1247 was not active across the tested cell lines when used as an extra control [PMC8602334]. The gene PCNXL3 has a significant correlation with colon adenocarcinoma and is listed among genes including MIR1247 that are associated with hyper-methylated regions in cancer compared to control samples [PMC5986643]. Furthermore, the regulation of MIR1247 has been associated with the growth and migration of gastric cancer cells [PMC7541134], and its expression is highly regulated across various diseases including diabetes and different types of malignancies [PMC5114726; PMC5966945].. Notably, an increase in miR-1247 expression was observed following treatment that reduced methylation levels of MIR1247 [PMC6251029].

Literature search
20 open access papers mention hsa-mir-1247
(147 sentences)

Sequence

1834 reads, 41 reads per million, 87 experiments
ccgcuugccucgcccagcgcagccccggccgcugggcgcACCCGUCCCGUUCGUCCCCGGAcguugcucucuaCCCCGGGAACGUCGAGACUGGAGCgcccgaacugagccaccuucgcggaccccgagagcggcg
.((((.((((((.((.(((.((....(((((.(((((((.((.(((.((..(((.(((((..((........)).))))).))).)).))).)).)))))))...)).)))..)).)))))....)))).))))))

Structure
c    u  -    ---c  a   c  cccc   -  --c       A  C   C  UU   C     Ac  ugc 
 cgcu gc cucg    cc gcg ag    ggc cg   ugggcgc CC GUC CG  CGU CCCGG  gu   u
 |||| || ||||    || ||| ||    ||| ||   ||||||| || ||| ||  ||| |||||  ||    
 gcgg cg gagc    gg cgc uc    ccg gu   gcccgCG GG CAG GC  GCA GGGCC  Ca   c
-    -  a    ccca  -   u  --ca   a  caa       A  U   A  -U   A     -C  ucu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101560287-101560422 [-]

Disease association
hsa-mir-1247 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1247-5p

Accession MIMAT0005899
Description Homo sapiens hsa-miR-1247-5p mature miRNA
Sequence 40 - ACCCGUCCCGUUCGUCCCCGGA - 61
Evidence experimental
Illumina [1]
Database links
Predicted targets

Mature hsa-miR-1247-3p

Accession MIMAT0022721
Description Homo sapiens hsa-miR-1247-3p mature miRNA
Sequence 74 - CCCCGGGAACGUCGAGACUGGAGC - 97
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621