Stem-loop hsa-mir-1248

Accession

MI0006383

Symbol

HGNC: MIR1248

Description

Homo sapiens hsa-mir-1248 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR1248 is a microRNA that may target a specific isoform of OGG1 due to differences in mRNA 3′UTR regions [PMC9118907]. In stallion sperm, MIR1248 is one of six miRNAs that show very high expression levels [PMC3569414]. It has 154 target genes and is upregulated in SK-N-SH and K562 cells [PMC5600530]. The relationship between PSMD10 expression levels and MIR1248 has been investigated [PMC9414407]. In TamR cells, MIR1248 is slightly upregulated with moderate absolute expression levels, along with other miRNAs [PMC3402532]. In old hematopoietic stem cells (HSC), MIR1248 has been found to be regulated along with an inflammation mediator NFKBIA [PMC8296523]. After IFN-γ stimulation, MIR1248 is one of the top 10 upregulated miRNAs [PMC8010072]. MIR1248 is a microRNA that may target a specific isoform of OGG1 due to differences in mRNA 3′UTR regions. The majority of miRNAs (76%) showed high expression level (10 AC 100), 13 miRNAs (16%) had AC lower than 10, whereas 6 miRNAs-MIR34B, MIR34C, MIR191, MIR223, MIR1248, and MIR1905C-showed very high expression levels (AC≥100) in stallion sperm. It has been found to have 154 target genes and be upregulated in SK-N-SH and K562. The relationship between PSMD10 expression levels and MIR1248 has been investigated. In TamR cells it was found to be slightly upregulated with moderate absolute expression levels along with other miRNAs. In old HSC, MIR1248 has been found to be regulated along with an inflammation mediator NFKBIA. After IFN-γ stimulation, MIR1248 is one of the top 10 upregulated miRNAs.

Literature search

16 open access papers mention hsa-mir-1248
(61 sentences)

Sequence

1022 reads, 198 reads per million, 115 experiments

uuuACCUUCUUGUAUAAGCACUGUGCUAAAauugcagacacuaggaccaugucuugguuuuugcaauaaugcuagcagaguacacacaagaagaaaaguaacagca
.....((((((((....(.(((.(((((..((((((((.((((((((...)))))))).)))))))).....))))).))).)..)))))))).............

Structure

--------uuuAC        AUAA C   G     ---AA        c        c 
             CUUCUUGU    G ACU UGCUA     auugcaga acuaggac  
             ||||||||    | ||| |||||     |||||||| |||||||| a
             gaagaaca    c uga acgau     uaacguuu ugguucug  
acgacaaugaaaa        --ca a   g     cguaa        u        u 

Annotation confidence Not enough data

Genome context

chr3: 186786672-186786777 [+]

Disease association

hsa-mir-1248 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-1248

• Accession: MIMAT0005900
• Description: Homo sapiens hsa-miR-1248 mature miRNA
• Sequence: 4 - ACCUUCUUGUAUAAGCACUGUGCUAAA - 30
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 18285502
   Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
   "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
   "Genome Res (2008) 18:610-621