WARNING: This summary was generated by AI. MIR1248 is a microRNA that exhibits a very high expression level in stallion sperm, with an expression count (AC) of 100 or greater, indicating its significant presence in these cells [PMC3569414]. It is known to target 154 genes and shows upregulation in certain human cell lines, such as SK-N-SH and K562 [PMC5600530]. Interestingly, MIR1248 may selectively target specific isoforms of OGG1 due to variations in the mRNA 3′UTR regions [PMC9118907]. In the context of drug resistance, MIR1248 is slightly up-regulated with moderate absolute expression levels in TamR cells [PMC3402532]. It has also been implicated in the regulation of genes associated with aging, as its regulation has been confirmed in old hematopoietic stem cells (HSC) compared to young HSC [PMC8296523]. Furthermore, MIR1248's expression levels are inversely correlated with PSMD10 expression levels [PMC9414407], and it is one of the top microRNAs that are upregulated following IFN-γ stimulation [PMC8010072]. This microRNA also shows differential regulation under conditions such as inflammation and drug resistance.
--------uuuAC AUAA C G ---AA c c
CUUCUUGU G ACU UGCUA auugcaga acuaggac
|||||||| | ||| ||||| |||||||| |||||||| a
gaagaaca c uga acgau uaacguuu ugguucug
acgacaaugaaaa --ca a g cguaa u u
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005900 |
| Description | Homo sapiens hsa-miR-1248 mature miRNA |
| Sequence | 4 - ACCUUCUUGUAUAAGCACUGUGCUAAA - 30 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|