MIR1249 is one of the top up-regulated genes in the study [PMC9279949]. It has been validated in different time points [PMC6006352]. Down-regulation of Dicer leads to decreased production of MIR1249 [PMC3316564]. MIR1249 inhibition can increase chemo-sensitivity by limiting the expansion of chemo-refractory cancer stem cells (CSCs) [PMC7>PMC7590111]. MIR1249 is associated with the Wnt signaling pathway [PMC7590111]. MIR1249 expression is increased in response to chemotherapy treatment in human cholangiocarcinoma (CCA) cells [PMC7590111]. Inhibition of MIR1249 reduces the enrichment of CD133+ cells, while its enforced expression reduces sensitivity to chemotherapy [PMC7590111'>PMC7590111]. MIR1249 plays a role in driving the expansion of CSCs and is associated with worse prognosis independently of adjuvant chemotherapy in BTC patients [PMC7590111]. CD133+ BTC cells express higher levels of MIR1249 compared to CD133- cells, and its inhibition enhances BTC cell response to chemotherapy treatment [PMC7590111]. FZD8 is a potential target gene regulated by MIR1249, and its inhibition recapitulates the phenotype induced by MIR1249 mimic [PMC7590111].\n\nReferences:\n.\n\nReferences:\n- PMC9279949\n-n- PMC6006352\n-n- PMC3316564\n-n- PMC7
----g A A U CAA cuc ggAGGAGGG GG GA GGGC GUUcc u ||||||||| || || |||| ||||| CUUCUUCCC CC CU CCCG CAagg g guccA - C U --- ucg
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005901 |
Description | Homo sapiens hsa-miR-1249-3p mature miRNA |
Sequence | 41 - ACGCCCUUCCCCCCCUUCUUCA - 62 |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
Accession | MIMAT0032029 |
Description | Homo sapiens hsa-miR-1249-5p mature miRNA |
Sequence | 4 - AGGAGGGAGGAGAUGGGCCAAGUU - 27 |
Evidence | not_experimental |
Database links | |
Predicted targets |
|