MIR1249 is a microRNA that has been identified as one of the top up-regulated genes in certain cellular contexts [PMC9279949]. It has been implicated in the regulation of chemo-resistance, particularly through its role in the expansion of CD133+ cancer stem cells (CSCs) [PMC7590111]. Inhibition of MIR1249 has been shown to increase chemo-sensitivity by limiting the expansion of resistant cell populations, suggesting its potential as a therapeutic target [PMC7590111]. MIR1249 is also associated with Wnt signaling pathways, with pathway analysis indicating an enrichment in Wnt signaling upon MIR1249 upregulation [PMC7590111]. Clinically, high tumor expression of MIR1249 correlates with a worse prognosis independently of adjuvant chemotherapy [PMC7590111'>PMC7590111]. Furthermore, pathway analysis revealed that inhibition of MIR1249 affects pathways deregulated by chemotherapy, indicating its role in mediating chemo-resistance through these pathways [PMC7590111]. In vivo studies have confirmed that knockout (KO) cells for MIR1249 exhibit reduced tumorigenicity and increased sensitivity to chemotherapy, reinforcing its significance in cancer progression and treatment resistance [PMC7590111].
----g A A U CAA cuc ggAGGAGGG GG GA GGGC GUUcc u ||||||||| || || |||| ||||| CUUCUUCCC CC CU CCCG CAagg g guccA - C U --- ucg
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005901 |
Description | Homo sapiens hsa-miR-1249-3p mature miRNA |
Sequence | 41 - ACGCCCUUCCCCCCCUUCUUCA - 62 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0032029 |
Description | Homo sapiens hsa-miR-1249-5p mature miRNA |
Sequence | 4 - AGGAGGGAGGAGAUGGGCCAAGUU - 27 |
Evidence | not_experimental |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|