MIR1256 is a microRNA that has been implicated in various types of cancer, including breast cancer, bladder tumors, and prostate cancer [PMC9775590]. In a study validating miRNA expression in ameloblastoma tumors, MIR1256 was found to be inconsistently expressed compared to non-ameloblastoma controls [PMC5354851]. Additionally, MIR1256 was found to bind to circHECTD1 and participate in the Ago2 complex [PMC7216265]. In another study, gains covering MIR1256 were observed in a patient with prostate cancer [PMC9775590]. Interestingly, the alteration of MIR1256 was associated with a hazard ratio of less than 1 [PMC8108987]. Furthermore, miR1299 and miR548X were also found to be overexpressed in ameloblastomas [PMC7920560]. Overall, MIR1256 is a microRNA that has been implicated in various types of cancer and has been found to be inconsistently expressed in ameloblastoma tumors. It also plays a role in circHECTD1 binding and participates in the Ago2 complex. Additionally, gains covering MIR1256 have been observed in prostate cancer patients. The alteration of MIR1256 is associated with a hazard ratio of less than 1. Furthermore, miR1299 and miR548X have also been found to be overexpressed in ameloblastomas.
------ gc uuugaagcuuu c G AC u a aguca cuguugaagc gaug cA GCAUUGACUUCUC UAGCUg ga ||||| |||||||||| |||| || ||||||||||||| |||||| || a ucggu gauaacuuug cuac gu cguaacugaagag aucgau cu acuuug -a ---------uu a a aa c g
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005907 |
Description | Homo sapiens hsa-miR-1256 mature miRNA |
Sequence | 35 - AGGCAUUGACUUCUCACUAGCU - 56 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|