Hsa-mir-1258 is a cellular miRNA that inhibits the reactivation of Kaposi's sarcoma-associated herpesvirus (KSHV) from latency and downregulates the expression of heparanase (HPSE) protein levels, which restricts breast cancer brain metastasis invasion [PMC7252873]. It is negatively correlated with several transmembrane emp24 domain-containing proteins (TMEDs) and is considered a tumor suppressor in breast cancer [PMC9816852]. Hsa-mir-1258 is upregulated in the skin of patients with postherpetic neuralgia (PHN) [PMC8914318]. It has also been found to be downregulated in gastric cancer and breast cancer, where it targets HPSE and reactivation transcriptional activator (RTA), respectively [PMC4350105] [PMC7354774]. Hsa-mir-1258 has been identified as one of the top upregulated differentially expressed miRNAs in ischemic stroke samples [PMC3565366]. It is also altered in metastatic cancers, including gastric cancer and acute myocardial infarction, where it may serve as a diagnostic biomarker [PMC4491873] [PMC9061009] [PMC8923688]. Overall, hsa-mir-1258 plays a role in inhibiting viral reactivation, regulating tumor metastasis, and may have diagnostic potential for certain diseases.
-- ugcg cuguggcuuccacgaccuaauccuaacucc a |||||||||||||||||||||||||||||| g gacaccgAAGGUGCUGGAUUAGGAUUGAgg u ag uccc
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005909 |
Description | Homo sapiens hsa-miR-1258 mature miRNA |
Sequence | 44 - AGUUAGGAUUAGGUCGUGGAA - 64 |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
|