MIR548N is a member of the microRNA 548 family, which has not been extensively studied in the context of disease processes, including its association with preterm birth or placental function [PMC5429750]. This microRNA, along with others in its family such as miR548a, miR548aa, miR548ai, and miR548ak, has been identified as brain-enriched and is a part of a group that includes precursors for various other microRNAs [PMC4468152]. Notably, MIR548N is located on chromosome 2 and has been found to be susceptible to somatic deletions of approximately 500 base pairs in patients with schizophrenia [PMC6756205]. These deletions also affect the PRKRA gene and have been observed specifically in DNA from the prefrontal cortex but not from cerebellum or blood [PMC3897957]. Additionally, MIR548N is situated within exon 6 of PRKRA and near a noncoding transcript at a genomic location associated with significant variant effects [PMC4289690]. The vulnerability of this region to mutation suggests that MIR548N may have an as-yet-undetermined role in neuropsychiatric conditions or other biological processes.
-- A c a agguuggugCAAAAGUAAUUGUGG UUUUGU guu |||||||||||||||||||||||| |||||| ||| a uccaaccacguuuucauuaacgcc aaaacg uaa aa c a a
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005916 |
| Description | Homo sapiens hsa-miR-548n mature miRNA |
| Sequence | 10 - CAAAAGUAAUUGUGGAUUUUGU - 31 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|