MIR1276 is a direct target gene of NF-κB in HeLa and HepG2 cells, and its expression is repressed by NF-κB [PMC7177739]. NF-κB upregulates the expression of CASP9 by directly binding to CASP9, but represses the expressions of MIR1276 and its host gene KLHL25 [PMC7177739]. CASP9 is a true target gene of MIR1276 [PMC7177739]. The level of snRNA U6 expression is used for the normalization of MIR1276 expression [PMC7177739'>PMC7177739'>PMC7177739'>PMC7177739]. TargetScan and DIANA-microT-CDS programs were used to predict the binding of MIR1276 to CASP9 mRNA, and it was confirmed that MIR1276 specifically binds to the 3′UTR of CASP9 [PMC7177739]. The expressions of MIR1276 and its host gene KLHL25 are similar in various cell types [PMC7177739]. NF-κB indirectly enhances CASP9 expression by directly repressing the expression of MIR1276 [PMC7177739]. The regulation between NF-κB, MIR1276, and CASP9 forms a coherent feed-forward loop (FFL) that upregulates the mRNA and protein levels of CASP9 in TNFα-treated cells [PMC7177739].
-- - gcu -A A C U ---- - g cc cca aggU AAG GC C GUGGAGACA c cug a || ||| |||| ||| || | ||||||||| | ||| gg ggu uccg uuc cg g caccucugu g gac u uc c agu gg a a u acaa a u
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005930 |
Description | Homo sapiens hsa-miR-1276 mature miRNA |
Sequence | 12 - UAAAGAGCCCUGUGGAGACA - 31 |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
|