miRBase entry: hsa-mir-1276

Stem-loop hsa-mir-1276


Accession
MI0006416
Symbol
HGNC: MIR1276
Description
Homo sapiens hsa-mir-1276 precursor miRNA mir-1276
Gene
family?
RF03453; mir-1276

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR1276 is a microRNA that has been identified as a direct target gene of NF-κB in TNFα-treated HeLa and HepG2 cells [PMC7177739]. NF-κB represses the expression of MIR1276 and its host gene KLHL25, which is consistent across various cell types [PMC7177739]. The repression of MIR1276 by NF-κB indirectly enhances the expression of the pro-apoptotic gene CASP9, as MIR1276 itself represses CASP9 expression at both mRNA and protein levels [PMC7177739]. Bioinformatic analysis has predicted potential binding sites for MIR1276 on the 3′UTR of CASP9 mRNA, which were confirmed by luciferase reporter assays [PMC7177739'>PMC7177739'>PMC7177739]. The study establishes a coherent feed-forward loop (FFL) involving NF-κB, MIR1276, and CASP9 that regulates apoptosis in TNFα-treated cells [PMC7177739]. Manipulation of cellular abundance of MIR1276 through transfection with mimics or expression plasmids confirmed its role in regulating CASP9 protein levels [PMC7177739]. This regulatory mechanism highlights the importance of understanding the biological role of NF-κB through its indirect regulation via microRNAs such as MIR1276 [PMC7177739].


Sequence

768 reads, 7 reads per million, 51 experiments
ccccagcuaggUAAAGAGCCCUGUGGAGACAccuggauucagagaacaugucuccacugagcacuugggccuugauggcggcu
(((((...((((.(((.((.(.(((((((((((((....))).)....))))))))).).)).)))..))))...))).))..

Structure
--  -   gcu    -A   A  C U         ---- -   g 
  cc cca   aggU  AAG GC C GUGGAGACA    c cug a
  || |||   ||||  ||| || | |||||||||    | |||  
  gg ggu   uccg  uuc cg g caccucugu    g gac u
uc  c   agu    gg   a  a u         acaa a   u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr15: 85770496-85770578 [-]

Disease association
hsa-mir-1276 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1276

Accession MIMAT0005930
Description Homo sapiens hsa-miR-1276 mature miRNA
Sequence 12 - UAAAGAGCCCUGUGGAGACA - 31
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621