WARNING: This summary was generated by AI. MIR1276 is a microRNA that has been identified as a direct target gene of NF-κB in TNFα-treated HeLa and HepG2 cells [PMC7177739]. NF-κB represses the expression of MIR1276 and its host gene KLHL25, which is consistent across various cell types [PMC7177739]. The repression of MIR1276 by NF-κB indirectly enhances the expression of the pro-apoptotic gene CASP9, as MIR1276 itself represses CASP9 expression at both mRNA and protein levels [PMC7177739]. Bioinformatic analysis has predicted potential binding sites for MIR1276 on the 3′UTR of CASP9 mRNA, which were confirmed by luciferase reporter assays [PMC7177739'>PMC7177739'>PMC7177739]. The study establishes a coherent feed-forward loop (FFL) involving NF-κB, MIR1276, and CASP9 that regulates apoptosis in TNFα-treated cells [PMC7177739]. Manipulation of cellular abundance of MIR1276 through transfection with mimics or expression plasmids confirmed its role in regulating CASP9 protein levels [PMC7177739]. This regulatory mechanism highlights the importance of understanding the biological role of NF-κB through its indirect regulation via microRNAs such as MIR1276 [PMC7177739].
-- - gcu -A A C U ---- - g cc cca aggU AAG GC C GUGGAGACA c cug a || ||| |||| ||| || | ||||||||| | ||| gg ggu ucCG UUC CG G CACCUCUGU g gac u uc c agu GG A A U acaa a u
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005930 |
| Description | Homo sapiens hsa-miR-1276-5p mature miRNA |
| Sequence | 12 - UAAAGAGCCCUGUGGAGACA - 31 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0060804 |
| Description | Homo sapiens hsa-miR-1276-3p mature miRNA |
| Sequence | 49 - UGUCUCCACUGAGCACUUGGGC - 70 |
| Evidence |
experimental
Illumina [1] |
|