---gaa gaaACU A AAA U ac
cauu GGCU GGGA UGA UGGAUagaa u
|||| |||| |||| ||| ||||||||| a
guaa CCGA CCCU AUU ACUUAUcuu u
aaaaaa -aACAU C --- U au
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005948 |
| Description | Homo sapiens hsa-miR-664a-5p mature miRNA |
| Sequence | 11 - ACUGGCUAGGGAAAAUGAUUGGAU - 34 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0005949 |
| Description | Homo sapiens hsa-miR-664a-3p mature miRNA |
| Sequence | 49 - UAUUCAUUUAUCCCCAGCCUACA - 71 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|