MIR1306 is a miRNA that has been found to be expressed in the brain, and it is conserved in mice [PMC4487986]. After IFN-γ stimulation, MIR1306 is one of the top 10 miRNAs that are upregulated [PMC8010072]. MIR1306 is highly expressed in reproductive organs, including the uterus and vagina, suggesting a potential role in abnormal pregnancy outcomes [PMC8645989]. It has been shown to inhibit the production of proinflammatory cytokines such as NF-κB and IL-1β [PMC8155903]. MIR1306 affects downstream cytokine expression by targeting key genes in the TLR4 pathway [PMC8155903]. The MIR1306 gene overlaps with the DGCR8 coding region and is conserved in primates [PMC7357559]. In studies based on the GSE94462 dataset, MIR1306 was among several miRNAs identified [PMC9922242]. It has also been reported as one of the most frequently affected miRNA genes in CAKUT CNVs, supporting its potential role in CAKUT [PMC9587983]. Among six identified miRNAs, only miR1226 showed statistically significant differences compared to controls [PMC6764711].
g a a -c UCCCCU A g g g ug gc gucu caCCACC GC AACGUCCA ug u c || || |||| ||||||| || |||||||| || | a gc ug cagg GUGGUGG CG UUGCAggu au g g a c a ua ---UCU G a g a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005950 |
Description | Homo sapiens hsa-miR-1306-3p mature miRNA |
Sequence | 55 - ACGUUGGCUCUGGUGGUG - 72 |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
Accession | MIMAT0022726 |
Description | Homo sapiens hsa-miR-1306-5p mature miRNA |
Sequence | 15 - CCACCUCCCCUGCAAACGUCCA - 36 |
Evidence | not_experimental |
Database links | |
Predicted targets |
|