WARNING: This summary was generated by AI. MIR1306 is a microRNA (miRNA) that is expressed in the brain and conserved in mice, suggesting a functional significance across species [PMC4487986]. It is one of the miRNAs that are upregulated in response to IFN-γ stimulation, indicating its potential involvement in immune responses [PMC8010072]. MIR1306 is also highly expressed in reproductive organs and may play a role in post-transcriptional processing that affects mRNA stability, which could be important for pregnancy outcomes [PMC8645989]. This miRNA has been shown to inhibit the production of proinflammatory cytokines by targeting key genes, which could be relevant for inflammatory processes [PMC8155903]. Additionally, MIR1306 affects cytokine expression through its interaction with the TLR4 pathway [PMC8155903]. The gene for MIR1306 overlaps with the DGCR8 coding region and is conserved among primates, suggesting a potential regulatory role within gene networks [PMC7357559]. Furthermore, MIR1306 has been identified as one of the most frequently affected miRNAs in congenital anomalies of the kidney and urinary tract (CAKUT), supporting its potential involvement in this condition as well [PMC9587983].
g a a -c UCCCCU A g g g ug gc gucu caCCACC GC AACGUCCA ug u c || || |||| ||||||| || |||||||| || | a gc ug cagg GUGGUGG CG UUGCAggu au g g a c a ua ---UCU G a g a
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005950 |
| Description | Homo sapiens hsa-miR-1306-3p mature miRNA |
| Sequence | 55 - ACGUUGGCUCUGGUGGUG - 72 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0022726 |
| Description | Homo sapiens hsa-miR-1306-5p mature miRNA |
| Sequence | 15 - CCACCUCCCCUGCAAACGUCCA - 36 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
|