MIR1307 is a microRNA implicated in various biological processes and diseases, including cancer and schizophrenia (SCZ) [PMC5804029]. It has been observed to have a threefold higher expression in controls compared to SCZ patients, suggesting a potential role in this condition [PMC5804029]. Furthermore, MIR1307 expression is differentially regulated across SCZ subtypes, with a tenfold higher expression in controls relative to the undifferentiated subtype [PMC5804029]. Studies have identified MIR1307 as a potential biomarker for certain chemotherapy responses, such as FOLFIRINOX in pancreatic ductal adenocarcinoma (PDAC) patients [PMC8602334]'>PMC8602334], and its disruption has been associated with increased sensitivity to this treatment [PMC8602334]. Additionally, MIR1307 has been linked to the regulation of the ING5 gene and may inhibit apoptosis in ovarian cancer cells by down-regulating ING5 expression [PMC8472271]. It also appears to contribute to drug resistance mechanisms by upregulating certain genes like HIST2H2BE in breast cancer [PMC8076833], and its high expression correlates with reduced benefit from chemotherapy in PDAC patients [PMC8602334]. Overall, MIR1307's differential expression patterns across various conditions highlight its potential as both a biomarker for disease and treatment response as well as a therapeutic target.
-- a -cc --- -ac --c c a U -A U A C uc ug cauca gac agcugag uc ugu acugccua c auc CGACCGG CC CG CCGG Ucg ug u ||||| ||| ||||||| || ||| |||||||| | ||| ||||||| || || |||| ||| || guggu uug ucgacuu ag acg uggcggau g ugG GCUGGCU GG GC GGCU Agc ac u ca c uuc uua cau uac a a U GC U - C ua cg
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005951 |
Description | Homo sapiens hsa-miR-1307-3p mature miRNA |
Sequence | 80 - ACUCGGCGUGGCGUCGGUCGUG - 101 |
Evidence |
experimental
Illumina [1], 454 [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0022727 |
Description | Homo sapiens hsa-miR-1307-5p mature miRNA |
Sequence | 41 - UCGACCGGACCUCGACCGGCU - 61 |
Evidence | not_experimental |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|