MIR1307 is a microRNA that has been found to be differentially expressed in various studies and is associated with different conditions and diseases, including schizophrenia (SCZ) [PMC5804029]. In a study on SCZ, MIR1307 showed a clear trend toward association with the same direction of effect in the data from the dorsolateral prefrontal cortex (DLPFC) [PMC5804029]. The expression of MIR1307 was found to be approximately threefold higher in controls compared to SCZ patients [PMC5804029]. MIR1307 has also been implicated in other diseases, such as ovarian cancer and gastric cancer [PMC8472271] [PMC7922229]. In ovarian cancer, MIR1307 was found to inhibit apoptosis by down-regulating the expression of ING5 [PMC8472271]. Additionally, MIR1307 has been proposed as a potential biomarker for patients who may benefit from certain chemotherapy regimens, such as FOLFIRINOX [PMC9764499] [PMC8602334]. It has also been associated with drug resistance in breast cancer and pancreatic ductal adenocarcinoma (PDAC) cells exposed to chemotherapy [PMC8076833] [PMC8602334]. The role of MIR1307 in mediating chemoresistance has been studied extensively, and it has been shown to affect sensitivity to platinum-containing regimens and DNA damage repair pathways [PMC8602334]. Furthermore, MIR1307 has been identified as a potential therapeutic target for SARS-CoV-2 infection prevention [PMC7354481].
-- a -cc --- -ac --c c a U -A U A C uc ug cauca gac agcugag uc ugu acugccua c auc CGACCGG CC CG CCGG Ucg ug u ||||| ||| ||||||| || ||| |||||||| | ||| ||||||| || || |||| ||| || guggu uug ucgacuu ag acg uggcggau g ugG GCUGGCU GG GC GGCU Agc ac u ca c uuc uua cau uac a a U GC U - C ua cg
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005951 |
Description | Homo sapiens hsa-miR-1307-3p mature miRNA |
Sequence | 80 - ACUCGGCGUGGCGUCGGUCGUG - 101 |
Evidence |
experimental
Illumina [1], 454 [2] |
Database links | |
Predicted targets |
Accession | MIMAT0022727 |
Description | Homo sapiens hsa-miR-1307-5p mature miRNA |
Sequence | 41 - UCGACCGGACCUCGACCGGCU - 61 |
Evidence | not_experimental |
Database links | |
Predicted targets |
|