miRBase entry: hsa-mir-1307

Stem-loop hsa-mir-1307


Accession
MI0006444
Symbol
HGNC: MIR1307
Description
Homo sapiens hsa-mir-1307 precursor miRNA mir-1307
Gene
family?
RF01038; mir-1307

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1307 is a microRNA implicated in various biological processes and diseases, including cancer and schizophrenia (SCZ) [PMC5804029]. It has been observed to have a threefold higher expression in controls compared to SCZ patients, suggesting a potential role in this condition [PMC5804029]. Furthermore, MIR1307 expression is differentially regulated across SCZ subtypes, with a tenfold higher expression in controls relative to the undifferentiated subtype [PMC5804029]. Studies have identified MIR1307 as a potential biomarker for certain chemotherapy responses, such as FOLFIRINOX in pancreatic ductal adenocarcinoma (PDAC) patients [PMC8602334]'>PMC8602334], and its disruption has been associated with increased sensitivity to this treatment [PMC8602334]. Additionally, MIR1307 has been linked to the regulation of the ING5 gene and may inhibit apoptosis in ovarian cancer cells by down-regulating ING5 expression [PMC8472271]. It also appears to contribute to drug resistance mechanisms by upregulating certain genes like HIST2H2BE in breast cancer [PMC8076833], and its high expression correlates with reduced benefit from chemotherapy in PDAC patients [PMC8602334]. Overall, MIR1307's differential expression patterns across various conditions highlight its potential as both a biomarker for disease and treatment response as well as a therapeutic target.

Literature search
19 open access papers mention hsa-mir-1307
(53 sentences)

Sequence

89204 reads, 275 reads per million, 155 experiments
caucaagacccagcugagucacugucacugccuaccaaucUCGACCGGACCUCGACCGGCUcgucuguguugccaaucgACUCGGCGUGGCGUCGGUCGUGguagauaggcggucaugcauacgaauuuucagcucuuguucuggugac
(((((.(((..(((((((((..(((.((((((((.(.(((.(((((((.((.((.((((.(((..((......))..))).)))))).))..))))))).))).).))))))))...)))...))...)))))))...))).)))))..

Structure
--     a   -cc       ---  -ac   --c        c a   U       -A  U  A    C   uc  ug 
  cauca gac   agcugag   uc   ugu   acugccua c auc CGACCGG  CC CG CCGG Ucg  ug  u
  ||||| |||   |||||||   ||   |||   |||||||| | ||| |||||||  || || |||| |||  ||   
  guggu uug   ucgacuu   ag   acg   uggcggau g ugG GCUGGCU  GG GC GGCU Agc  ac  u
ca     c   uuc       uua  cau   uac        a a   U       GC  U  -    C   ua  cg 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr10: 103394253-103394401 [-]

Disease association
hsa-mir-1307 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1307-3p

Accession MIMAT0005951
Description Homo sapiens hsa-miR-1307-3p mature miRNA
Sequence 80 - ACUCGGCGUGGCGUCGGUCGUG - 101
Evidence experimental
Illumina [1], 454 [2]
Database links
Predicted targets

Mature hsa-miR-1307-5p

Accession MIMAT0022727
Description Homo sapiens hsa-miR-1307-5p mature miRNA
Sequence 41 - UCGACCGGACCUCGACCGGCU - 61
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 19144710
    Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas
    "Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G"
    "J Virol (2009) 83:3333-3341

  2. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621