Stem-loop vvi-MIR159a

Accession

MI0006493

Description

Vitis vinifera vvi-MIR159a precursor miRNA

Literature search

7 open access papers mention vvi-MIR159a
(14 sentences)

Sequence

1 reads, 0 reads per million, 1 experiments

ggguuuaugggagcuccuuuacgcuccaguucugaaaggagaugaugguauccacagcugcugguucaugaguaccuauggcugcacaauauauauagcaauguugugugcaaacuaugggugugcaugaccucggagaagugguugccuugaucuuucuggcCUUGGAGUGAAGGGAGCUCUCauaacccuuc
(((((.((((((((((((((.((((((((..(((...((((((.(.((((.((((..((.(.(((.((((..(((((((((.((((((..((((......))))..))))))..)))))))))..)))))))..).))..)))).)))).).)))))).)))..)))))))))))))))))))))))))))...

Structure

---     u              a        uu   aaa      g u    u    ag  g -u   u    ag         -c      au    au 
   ggguu augggagcuccuuu cgcuccag  cug   ggagau a ggua ccac  cu c  ggu caug  uaccuaugg  ugcaca  auau  a
   ||||| |||||||||||||| ||||||||  |||   |||||| | |||| ||||  || |  ||| ||||  |||||||||  ||||||  ||||   
   cccaa uaCUCUCGAGGGAA GUGAGGUU  ggu   uuucua u ccgu ggug  ga g  cca guac  guggguauc  acgugu  ugua  g
cuu     -              -        Cc   --c      g u    u    aa  g cu   -    gu         aa      gu    ac 

Annotation confidence Not enough data

Genome context

chr15: 18469173-18469366 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from vvi-MIR159a

Mature vvi-miR159a

• Accession: MIMAT0005648
• Description: Vitis vinifera vvi-miR159a mature miRNA
• Sequence: 164 - CUUGGAGUGAAGGGAGCUCUC - 184
• Evidence: experimental ; Array [2]

References

1. PubMed ID: 17721507
   The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
   "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
   "Nature (2007) 449:463-467


2. PubMed ID: 19939267
   High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
   Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
   BMC Genomics (2009) 10:558