miRBase entry: vvi-MIR166e

Stem-loop vvi-MIR166e


Accession
MI0006511
Description
Vitis vinifera vvi-MIR166e precursor miRNA

Literature search
8 open access papers mention vvi-MIR166e
(16 sentences)

Sequence

2199910 reads, 147508 reads per million, 2 experiments
guguuuugaggggaauguugucuggcucgaggacaccaacuagaucuaugaucugcguguaauugugaaugggugaucgucucucaguuuugaaggagagauuuugagugaucuuugaucauggguuggugucgUCGGACCAGGCUUCAUUCCCCccaauuuauug
.....(((.((((((((..((((((.((((.((((((((((.((((..(.((.((((......)))).)).)..))))(((((((..........))))))).....((((((...)))))).)))))))))).)))).))))))..)))))))).))).......

Structure
--guguu   a        uu      c    g          --------------------------------------------a    ua g  c    ug 
       uug ggggaaug  gucugg ucga gacaccaacu                                             gauc  u au ugcg  u
       ||| ||||||||  |||||| |||| ||||||||||                                             ||||  | || ||||   
       aac CCCCUUAC  CGGACC GGCU cugugguugg                                             cuag  g ua gugu  a
guuauuu   c        UU      A    g          guacuaguuucuagugaguuuuagagaggaaguuuugacucucug    ug g  a    ua 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr2: 2255722-2255887 [+]

Database links

Mature vvi-miR166e

Accession MIMAT0005666
Description Vitis vinifera vvi-miR166e mature miRNA
Sequence 135 - UCGGACCAGGCUUCAUUCCCC - 155
Evidence experimental
Array [2], Illumina [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558