Stem-loop vvi-MIR166e

Accession

MI0006511

Description

Vitis vinifera vvi-MIR166e precursor miRNA

Gene family

MIPF0000004; MIR166

Literature search

8 open access papers mention vvi-MIR166e
(16 sentences)

Sequence

2199914 reads, 147511 reads per million, 2 experiments

guguuuugaggggaauguugucuggcucgaggacaccaacuagaucuaugaucugcguguaauugugaaugggugaucgucucucaguuuugaaggagagauuuugagugaucuuugaucauggguuggugucgUCGGACCAGGCUUCAUUCCCCccaauuuauug
.....(((.((((((((..((((((.((((.((((((((((.((((..(.((.((((......)))).)).)..))))(((((((..........))))))).....((((((...)))))).)))))))))).)))).))))))..)))))))).))).......

Structure

--guguu   a        uu      c    g          --------------------------------------------a    ua g  c    ug 
       uug ggggaaug  gucugg ucga gacaccaacu                                             gauc  u au ugcg  u
       ||| ||||||||  |||||| |||| ||||||||||                                             ||||  | || ||||   
       aac CCCCUUAC  CGGACC GGCU cugugguugg                                             cuag  g ua gugu  a
guuauuu   c        UU      A    g          guacuaguuucuagugaguuuuagagaggaaguuuugacucucug    ug g  a    ua 

Annotation confidence Not enough data

Genome context

chr2: 2255722-2255887 [+]

Mature vvi-miR166e

• Accession: MIMAT0005666
• Description: Vitis vinifera vvi-miR166e mature miRNA
• Sequence: 135 - UCGGACCAGGCUUCAUUCCCC - 155
• Evidence: experimental ; Array [2], Illumina [2]

References

1. PubMed ID: 17721507
   The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
   "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
   "Nature (2007) 449:463-467


2. PubMed ID: 19939267
   High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
   Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
   BMC Genomics (2009) 10:558