miRBase entry: vvi-MIR167d

Stem-loop vvi-MIR167d


Accession
MI0006518
Description
Vitis vinifera vvi-MIR167d precursor miRNA

Literature search
7 open access papers mention vvi-MIR167d
(12 sentences)

Sequence

965233 reads, 64722 reads per million, 2 experiments
agggaauaagUGAAGCUGCCAGCAUGAUCUAgcuuuggcuagggauacagagaaagagagagaucagagcuaacccuagcuaggucaugcccugacagccucacuccuuccuucu
.(((((..(((((.((((.(((((((((((((((((((((...(((................)))..))))))....)))))))))))))..)).)))).)))))..)))))...

Structure
--a     ua     A    C  --             ----      agg   acagaga 
   gggaa  agUGA GCUG CA  GCAUGAUCUAgcu    uuggcu   gau       a
   |||||  ||||| |||| ||  |||||||||||||    ||||||   |||        
   uccuu  ucacu cgac gu  cguacuggaucga    aaucga   cua       a
ucu     cc     c    a  cc             uccc      -ga   gagagag 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
NW_003724203.1: 254821-254935 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from vvi-MIR167d
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR167d

Accession MIMAT0005673
Description Vitis vinifera vvi-miR167d mature miRNA
Sequence 11 - UGAAGCUGCCAGCAUGAUCUA - 31
Evidence experimental
Array [2], Illumina [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558