miRBase entry: vvi-MIR168

Stem-loop vvi-MIR168


Accession
MI0006520
Description
Vitis vinifera vvi-MIR168 precursor miRNA

Literature search
5 open access papers mention vvi-MIR168
(35 sentences)

Sequence

225870 reads, 15147 reads per million, 2 experiments
ggucucuaauUCGCUUGGUGCAGGUCGGGAAccgacuucgccgcuccggcagcgccggaggcacgcggcggccuacgauugguugcugagcgaauuccgaucccgccuugcaucaacugaaucggagacggc
.((((((.(((((.((((((((((.(((((.(.((.(((((..(((((((...))))))).....((((((((.......)))))))).))))).)).).))))).)))))))))).))))).))))))...

Structure
--g      a     C          U     A c  c     cgcuccggcagcgccggaggcacg        ua 
   gucucu auUCG UUGGUGCAGG CGGGA c ga uucgc                        cggcggcc  c
   |||||| ||||| |||||||||| ||||| | || |||||                        ||||||||  g
   cagagg uaagu aacuacguuc gcccu g cu aagcg                        gucguugg  a
cgg      c     c          c     a c  u     -----------------------a        uu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr2: 17944801-17944932 [-]

Database links

Mature vvi-miR168

Accession MIMAT0005675
Description Vitis vinifera vvi-miR168 mature miRNA
Sequence 11 - UCGCUUGGUGCAGGUCGGGAA - 31
Evidence experimental
Array [2], Illumina [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558