miRBase entry: vvi-MIR169f

Stem-loop vvi-MIR169f


Accession
MI0006526
Description
Vitis vinifera vvi-MIR169f precursor miRNA

Literature search
8 open access papers mention vvi-MIR169f
(19 sentences)

Sequence

3646 reads, 245 reads per million, 2 experiments
gauauuauggugCAGCCAAGGAUGACUUGCCGAaaauaauuugcucgaucguuaaugugcuucuccaguuucuauugcaauuuaugcauagggcaauauauauauccuuuauagcuuguuaauucagauauugacugaggaaucaauaaugggcaaguuguguuuggcuacauguuuaucucau
((((.....(((.(((((((.((((((((((.........((.((((...((((((((.((..........((((.(((.....)))))))(((((..((((.......))))..))))).....)))))))))))))).)).........)))))))))).))))))).)))...))))....

Structure
----    uuaug   C       G          GAaaauaau  g    auc        g  ucuccaguuucuauugcaauuuaugcauag     ua    ua 
    gaua     gug AGCCAAG AUGACUUGCC         uu cucg   guuaaugu cu                              ggcaa  uaua  u
    ||||     ||| ||||||| ||||||||||         || ||||   |||||||| ||                              |||||  ||||  c
    cuau     uac ucgguuu uguugaacgg         aa gagu   caguuaua ga                              uuguu  auau  c
uacu    --uug   a       g          guaauaacu  g    ---        -  -------------------------cuuaa     cg    uu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 12404208-12404391 [+]

Database links

Mature vvi-miR169f

Accession MIMAT0005681
Description Vitis vinifera vvi-miR169f mature miRNA
Sequence 13 - CAGCCAAGGAUGACUUGCCGA - 33
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558