miRBase entry: vvi-MIR172c

Stem-loop vvi-MIR172c


Accession
MI0006546
Description
Vitis vinifera vvi-MIR172c precursor miRNA

Literature search
10 open access papers mention vvi-MIR172c
(38 sentences)

Sequence

19 reads, 1 reads per million, 2 experiments
guuugcggauggagcaucaucaagauucacaaguauugagacucagugcgugguggugauggugacuuuuguggucccuuccuacacuccgauggcucuuugaugugGGAAUCUUGAUGAUGCUGCAGcggcaauaaa
..((((.(.((.((((((((((((((((.((......((((.(((.((.(.(((((.((.((.((((.....)))))).)))))).).))).))).)))).....)).)))))))))))))))).)).).))))....

Structure
--gu    g a  g                a  aguauu    c   g  c u -    u  u  u    u 
    uugc g ug agcaucaucaagauuc ca      gaga uca ug g g gugg ga gg gacu u
    |||| | || |||||||||||||||| ||      |||| ||| || | | |||| || || |||| u
    aacg c AC UCGUAGUAGUUCUAAG gu      uucu ggu gc c c cauc cu cc cugg g
aaau    g G  G                G  -guagu    c   a  - u a    -  u  -    u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr13: 3217507-3217644 [+]

Database links

Mature vvi-miR172c

Accession MIMAT0005701
Description Vitis vinifera vvi-miR172c mature miRNA
Sequence 108 - GGAAUCUUGAUGAUGCUGCAG - 128
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558