miRBase entry: vvi-MIR319c

Stem-loop vvi-MIR319c


Accession
MI0006549
Description
Vitis vinifera vvi-MIR319c precursor miRNA

Literature search
7 open access papers mention vvi-MIR319c
(27 sentences)

Sequence

6294 reads, 422 reads per million, 2 experiments
uuacauugaagagagcuuucuucaguccacucauggguggcaguaggauugaauuagcugccgacucauucauccaaauacuguguuaaggacuacccaguaaaugauugaaugaugcgggagacaaauuggaucuuaagcucccugugcUUGGACUGAAGGGAGCUCCCUucacugcaauc
...((.(((((.(((((((((((((((((..((((((.(((..(((((((.((((.(((.(((..(((((((..((..(((((.((........)).)))))..))..)))))))..))).)).).)))).))))))).))).))))))..))))))))))))))))).))))).)).....

Structure
--uua  u     a                 cu      u   ag       g    a -  g   ac       uc  aa     u  uaa 
     ca ugaag gagcuuucuucagucca  cauggg ggc  uaggauu aauu g cu ccg  ucauuca  ca  uacug gu   g
     || ||||| |||||||||||||||||  |||||| |||  ||||||| |||| | || |||  |||||||  ||  ||||| ||    
     gu acuUC CUCGAGGGAAGUCAGGU  gugucc ucg  auucuag uuaa c ga ggc  aguaagu  gu  augac ca   g
cuaac  c     C                 Uc      c   -a       g    a a  g   gu       ua  aa     c  uca 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr2: 855561-855742 [-]

Database links

Mature vvi-miR319c

Accession MIMAT0005704
Description Vitis vinifera vvi-miR319c mature miRNA
Sequence 151 - UUGGACUGAAGGGAGCUCCCU - 171
Evidence experimental
Array [2], Illumina [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558