miRBase entry: vvi-MIR395a

Stem-loop vvi-MIR395a


Accession
MI0006556
Description
Vitis vinifera vvi-MIR395a precursor miRNA

Literature search
6 open access papers mention vvi-MIR395a
(30 sentences)

Sequence

7044 reads, 473 reads per million, 2 experiments
guccccuagaguucccuugaucacuucacuagggagcuucgcuaguuuuaaugacuuccuaCUGAAGUGUUUGGGGGAACUCcugguaccga
....((..((((((((((((.(((((((.((((((((...............).))))))).))))))).))))))))))))..))......

Structure
--gucc  ua            u       c       - uucgcu 
      cc  gaguucccuuga cacuuca uagggag c      a
      ||  |||||||||||| ||||||| ||||||| |      g
      gg  CUCAAGGGGGUU GUGAAGU auccuuc g      u
agccau  uc            U       C       a uaauuu 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr1: 6527928-6528019 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from vvi-MIR395a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR395a

Accession MIMAT0005711
Description Vitis vinifera vvi-miR395a mature miRNA
Sequence 62 - CUGAAGUGUUUGGGGGAACUC - 82
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558