miRBase entry: vvi-MIR395b

Stem-loop vvi-MIR395b


Accession
MI0006557
Description
Vitis vinifera vvi-MIR395b precursor miRNA

Literature search
6 open access papers mention vvi-MIR395b
(23 sentences)

Sequence

7051 reads, 475 reads per million, 2 experiments
guccccuagaguuccccuuaccacuucacuggggaucuucucuaaugaaugccuacguaCUGAAGUGUUUGGGGGAACUCcuggugccau
....((..((((((((((...((((((((((((.((..((......)))).)))).))...))))))...))))))))))..))......

Structure
--gucc  ua          uac      ---  -    g  cu  uc 
      cc  gaguuccccu   cacuuc   ac uggg au  uc  u
      ||  ||||||||||   ||||||   || |||| ||  ||   
      gg  CUCAAGGGGG   GUGAAG   ug aucc ua  ag  a
uaccgu  uc          UUU      UCa  c    g  --  ua 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 6502664-6502753 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from vvi-MIR395b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR395b

Accession MIMAT0005712
Description Vitis vinifera vvi-miR395b mature miRNA
Sequence 60 - CUGAAGUGUUUGGGGGAACUC - 80
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558