miRBase entry: vvi-MIR395c

Stem-loop vvi-MIR395c


Accession
MI0006558
Description
Vitis vinifera vvi-MIR395c precursor miRNA

Literature search
6 open access papers mention vvi-MIR395c
(23 sentences)

Sequence

7106 reads, 479 reads per million, 2 experiments
guccccuagaguucccuugaccacuucacuggggaccuucucuaguuauaaugacuuccuaCUGAAGUGUUUGGGGGAACUCcuggugccau
....((..((((((((((((.(((((((.((((((...((..((....))..)).)))))).))))))).))))))))))))..))......

Structure
--gucc  ua            c       c      ccu  uc  g 
      cc  gaguucccuuga cacuuca ugggga   uc  ua u
      ||  |||||||||||| ||||||| ||||||   ||  ||  
      gg  CUCAAGGGGGUU GUGAAGU auccuu   ag  au u
uaccgu  uc            U       C      --c  ua  a 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 6499914-6500005 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from vvi-MIR395c
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR395c

Accession MIMAT0005713
Description Vitis vinifera vvi-miR395c mature miRNA
Sequence 62 - CUGAAGUGUUUGGGGGAACUC - 82
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558