miRBase entry: vvi-MIR395g

Stem-loop vvi-MIR395g


Accession
MI0006562
Description
Vitis vinifera vvi-MIR395g precursor miRNA

Literature search
6 open access papers mention vvi-MIR395g
(23 sentences)

Sequence

7058 reads, 476 reads per million, 2 experiments
guccccuagaguuccccugagcacuucauuggggauccuuaguuuucaauuccuaCUGAAGUGUUUGGGGGAACUCccggugucau
(.(.((..((((((((((((((((((((.(((((((............))))))).))))))))))))))))))))..)).).)..

Structure
-- u c  ua                    u       ccuua 
  g c cc  gaguuccccugagcacuuca uggggau     g
  | | ||  |||||||||||||||||||| |||||||      
  c g gg  CUCAAGGGGGUUUGUGAAGU auccuua     u
ua u u  cc                    C       acuuu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 6482113-6482198 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from vvi-MIR395g
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR395g

Accession MIMAT0005717
Description Vitis vinifera vvi-miR395g mature miRNA
Sequence 56 - CUGAAGUGUUUGGGGGAACUC - 76
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558