miRBase entry: vvi-MIR395l

Stem-loop vvi-MIR395l


Accession
MI0006567
Description
Vitis vinifera vvi-MIR395l precursor miRNA

Literature search
6 open access papers mention vvi-MIR395l
(23 sentences)

Sequence

7056 reads, 473 reads per million, 2 experiments
gcccccuagaguuccccugaccacuucacugggggaucuucuguaaugacuuccuaCUGAAGUGUUUGGGGGAACUCcuggugucau
....((..((((((((((((.(((((((.((((((.((.........)).)))))).))))))).))))))))))))..))......

Structure
--gccc  ua            c       c      a  uuc 
      cc  gaguuccccuga cacuuca uggggg uc   u
      ||  |||||||||||| ||||||| |||||| ||   g
      gg  CUCAAGGGGGUU GUGAAGU auccuu ag   u
uacugu  uc            U       C      c  uaa 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr1: 6559098-6559184 [+]
Clustered miRNAs
4 other miRNAs are < 10 kb from vvi-MIR395l
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR395l

Accession MIMAT0005722
Description Vitis vinifera vvi-miR395l mature miRNA
Sequence 57 - CUGAAGUGUUUGGGGGAACUC - 77
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558