miRBase entry: vvi-MIR399g

Stem-loop vvi-MIR399g


Accession
MI0006576
Description
Vitis vinifera vvi-MIR399g precursor miRNA

Literature search
4 open access papers mention vvi-MIR399g
(10 sentences)

Sequence

41 reads, 3 reads per million, 2 experiments
augaauugcugggcaauacuccauuggcaguuggccacucggcugaccgcgguugacuucacaaguagcagacuaagcucacUGCCAAAGGAGAUUUGCCCCUcaauucagcu
.(((((((..((((((..((((.((((((((.(((...((.((((...(.((......)).)...)))).))....))).)))))))).))))..))))))..)))))))...

Structure
--a       cu      ua    a        u   -cac  g    acc c  uu 
   ugaauug  gggcaa  cucc uuggcagu ggc    uc gcug   g gg  g
   |||||||  ||||||  |||| |||||||| |||    || ||||   | ||   
   acuuaac  CCCGUU  GAGG AACCGUca ucg    ag cgau   c cu  a
ucg       UC      UA    A        c   aauc  a    gaa a  uc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr10: 2981247-2981359 [-]
Clustered miRNAs
3 other miRNAs are < 10 kb from vvi-MIR399g
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR399g

Accession MIMAT0005731
Description Vitis vinifera vvi-miR399g mature miRNA
Sequence 83 - UGCCAAAGGAGAUUUGCCCCU - 103
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558