miRBase entry: gma-MIR1509a

Stem-loop gma-MIR1509a


Accession
MI0007221
Description
Glycine max gma-MIR1509a precursor miRNA

Literature search
12 open access papers mention gma-MIR1509a
(27 sentences)

Sequence

cugcaucuucUUAAUCAAGGAAAUCACGGUCGcgugugugccggaaagaaaguggccugugaucuccgguuucucuuucucgaccguguuuccuugguuaacgauaugugc
..((((..(((((((((((((((.((((((((.(.....((((((.....((....))......))))))........).))))))))))))))))))))).))...))))

Structure
cu    -cu  -             U        c ---ugugu      -aagaa  u 
  gcau   uc UUAAUCAAGGAAA CACGGUCG g        gccgga      ag g
  ||||   || ||||||||||||| |||||||| |        ||||||      ||  
  cgug   ag aauugguuccuuu gugccagc c        uggccu      uc g
--    uau  c             -        u uuucucuu      cuagug  c 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr17: 9813056-9813166 [+]

Database links

Mature gma-miR1509a

Accession MIMAT0007367
Description Glycine max gma-miR1509a mature miRNA
Sequence 11 - UUAAUCAAGGAAAUCACGGUCG - 32
Evidence experimental
454 [1,4], cloned [2], Illumina [3]

References

  1. PubMed ID: 18402695
    Novel and nodulation-regulated microRNAs in soybean roots
    Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O
    BMC Genomics (2008) 9:160

  2. PubMed ID: 20122185
    Prediction of novel miRNAs and associated target genes in Glycine max
    Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
    BMC Bioinformatics (2010) 11:S14

  3. PubMed ID: 19084500
    Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules
    "Wang Y, Li P, Cao X, Wang X, Zhang A, Li X"
    "Biochem Biophys Res Commun (2009) 378:799-803

  4. PubMed ID: 21504877
    MicroRNAs in the shoot apical meristem of soybean
    "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
    "J Exp Bot (2011) 62:2495-2506