Stem-loop gma-MIR1510a

Accession

MI0007222

Description

Glycine max gma-MIR1510a precursor miRNA

Literature search

17 open access papers mention gma-MIR1510a
(42 sentences)

Sequence

uuauggaacuggAGGGAUAGGUAAAACAAUGACUGCuguauaaguaauuguuauaguuagUUGUUGUUUUACCUAUUCCACCCauuccaugua
.(((((((..((.((((((((((((((((((((((((((((((....))).))))).)))))))))))))))))))))).))..)))))))..

Structure

-u       cu  A                      -     -   g 
  uauggaa  gg GGGAUAGGUAAAACAAUGACUG Cugua uaa u
  |||||||  || |||||||||||||||||||||| ||||| |||  
  guaccuu  CC CCUUAUCCAUUUUGUUGUUgau gauau guu a
au       aC  A                      u     u   a 

Annotation confidence Not enough data

Genome context

chr16: 31887382-31887474 [+]

Mature gma-miR1510a-5p

• Accession: MIMAT0017338
• Description: Glycine max gma-miR1510a-5p mature miRNA
• Sequence: 13 - AGGGAUAGGUAAAACAAUGACUGC - 36
• Evidence: experimental ; Illumina [3,5], 454 [4]

Mature gma-miR1510a-3p

• Accession: MIMAT0007368
• Description: Glycine max gma-miR1510a-3p mature miRNA
• Sequence: 61 - UUGUUGUUUUACCUAUUCCACCC - 83
• Evidence: experimental ; 454 [1,4], Northern [1], cloned [2], Illumina [6]

References

1. PubMed ID: 18402695
   Novel and nodulation-regulated microRNAs in soybean roots
   Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O
   BMC Genomics (2008) 9:160


2. PubMed ID: 20122185
   Prediction of novel miRNAs and associated target genes in Glycine max
   Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
   BMC Bioinformatics (2010) 11:S14


3. PubMed ID: 19084500
   Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules
   "Wang Y, Li P, Cao X, Wang X, Zhang A, Li X"
   "Biochem Biophys Res Commun (2009) 378:799-803


4. PubMed ID: 21504877
   MicroRNAs in the shoot apical meristem of soybean
   "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
   "J Exp Bot (2011) 62:2495-2506


5. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553


6. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153