Stem-loop gma-MIR1521a

Accession

MI0007236

Description

Glycine max gma-MIR1521a precursor miRNA

Literature search

2 open access papers mention gma-MIR1521a
(2 sentences)

Sequence

uacucauugaCUGUUAAUGGAAAAUGUUGAcugccaaaugucauaauccuauuggauguuaaaauuguauacgaaaauucacguccaauaugauuaugacauaugacaguuaacguuacccauuaacagucaacguccaauaaaauugugacacauaacagucaacauuauucaauaacaauuaauguuc
......((((((((((((((..(((((((((((.((.(((((((((((.((((((((((...((((.........)))).)))))))))).))))))))))).)).)))))))))))..)))))))))))))).(((((((...)))).)))...........(((((((............))))))).

Structure

---------------------------------------------------uacuca              AA           c  a           c          uaa    gua 
                                                         uugaCUGUUAAUGG  AAUGUUGAcug ca augucauaauc uauuggaugu   aauu   u
                                                         ||||||||||||||  ||||||||||| || ||||||||||| ||||||||||   ||||   a
                                                         aacugacaauuacc  uugcaauugac gu uacaguauuag auaaccugca   uuaa   c
cuuguaauuaacaauaacuuauuacaacugacaauacacaguguuaaaauaaccugc              ca           a  a           u          --c    aag 

Annotation confidence Not enough data

Genome context

chr11: 12131319-12131508 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from gma-MIR1521a

Mature gma-miR1521a

• Accession: MIMAT0007382
• Description: Glycine max gma-miR1521a mature miRNA
• Sequence: 11 - CUGUUAAUGGAAAAUGUUGA - 30
• Evidence: experimental ; 454 [1], Illumina [2]

References

1. PubMed ID: 18402695
   Novel and nodulation-regulated microRNAs in soybean roots
   Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O
   BMC Genomics (2008) 9:160


2. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153