Stem-loop mml-mir-877

Accession

MI0007918

Description

Macaca mulatta mml-mir-877 precursor miRNA

Sequence

4647 reads, 35 reads per million, 8 experiments

gcuagagaagGUAGAGGAGAUGGCGCAGGGgacacgggcuaagacucggggguuccugggacccucagacauguguCCUCUUCUCCCUCCUCCCAgguguaug
.........((..((((((..((.(.((((((((((((......)))((((((((...))))))))......))))))))).).)))))))))).........

Structure

gcuagagaa  UA      AU  C C         gggcuaagacuc        c 
         gG  GAGGAG  GG G AGGGgacac            ggggguuc  
         ||  ||||||  || | |||||||||            |||||||| u
         CC  CUCCUC  CC C UCUCCugug            cucccagg  
guauguggA  --      --  U U         ------uacaga        g 

Annotation confidence Not enough data

Genome context

chr4: 31285374-31285476 [+]

Mature mml-miR-877-5p

• Accession: MIMAT0006521
• Description: Macaca mulatta mml-miR-877-5p mature miRNA
• Sequence: 11 - GUAGAGGAGAUGGCGCAGGG - 30
• Evidence: experimental ; Illumina [2]

Mature mml-miR-877-3p

• Accession: MIMAT0026911
• Description: Macaca mulatta mml-miR-877-3p mature miRNA
• Sequence: 77 - CCUCUUCUCCCUCCUCCCA - 95
• Evidence: experimental ; Illumina [2]

References

1. PubMed ID: 18186931
   Identification of novel homologous microRNA genes in the rhesus macaque genome
   Yue J, Sheng Y, Orwig KE
   BMC Genomics (2008) 9:8


2. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45