miRBase entry: vvi-MIR169q

Stem-loop vvi-MIR169q


Accession
MI0007946
Description
Vitis vinifera vvi-MIR169q precursor miRNA

Literature search
8 open access papers mention vvi-MIR169q
(15 sentences)

Sequence

360 reads, 24 reads per million, 2 experiments
aggguggaauaGAGCCAAGGAUGACUUGCCGGcauuugcaguaagucuauauuaacuggaacagccggcauguaauccuggcucuauuugguccucu
(((((.(((((((((((.((((.((.(((((((..((.((((.(((....))).)))).))..))))))).)).))))))))))))))).)))))..

Structure
--     g           A    G  U       au  g    a   c 
  agggu gaauaGAGCCA GGAU AC UGCCGGc  uu cagu agu u
  ||||| ||||||||||| |||| || |||||||  || |||| |||  
  uccug uuuaucucggu ccua ug acggccg  aa guca uua a
uc     g           -    a  u       ac  g    a   u 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr11: 16384484-16384580 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from vvi-MIR169q
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR169q

Accession MIMAT0006551
Description Vitis vinifera vvi-miR169q mature miRNA
Sequence 12 - GAGCCAAGGAUGACUUGCCGG - 32
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558