miRBase entry: vvi-MIR169w

Stem-loop vvi-MIR169w


Accession
MI0007948
Description
Vitis vinifera vvi-MIR169w precursor miRNA

Literature search
8 open access papers mention vvi-MIR169w
(21 sentences)

Sequence

3661 reads, 246 reads per million, 2 experiments
gguuauguggugCAGCCAAGGAUGACUUGCCGGcaacucccuuuauuguacucaugcaugcucauacuuauacuguugugggcaucauuuaaguggcaaaaaugguggucggcgagucauucuuagcuacauuucugccucau
(((...(.((((.(((.(((((((((((((((((....((.(((.(((((((.(((.((((((((((.......).))))))))))))...))).))))))).))..))))))))))))))))).))).)))).).)))....

Structure
----   uau u    C   C                 aacu  c   a    -   --c   c         - uu 
    ggu   g ggug AGC AAGGAUGACUUGCCGGc    cc uuu uugu acu   aug augcucaua c  a
    |||   | |||| ||| |||||||||||||||||    || ||| |||| |||   ||| ||||||||| |  u
    ccg   c uuac ucg uucuuacugagcggcug    gg aaa aacg uga   uac uacgggugu g  a
uacu   --u u    a   a                 --gu  u   -    g   auu   -         u uc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr14: 29685614-29685756 [+]

Database links

Mature vvi-miR169w

Accession MIMAT0006553
Description Vitis vinifera vvi-miR169w mature miRNA
Sequence 13 - CAGCCAAGGAUGACUUGCCGG - 33
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558