miRBase entry: vvi-MIR482

Stem-loop vvi-MIR482


Accession
MI0007971
Description
Vitis vinifera vvi-MIR482 precursor miRNA

Literature search
7 open access papers mention vvi-MIR482
(15 sentences)

Sequence

14843 reads, 995 reads per million, 2 experiments
aauguuugggaauuggagaguaggaaagcuuagccaucuauucccuucaugguuuccucuccauggauugggggucuagagcuagUCUUUCCUACUCCUCCCAUUCCuauuguuuuc
......(((((((.((((((((((((((.(((((..((((..((((((((((........))))))....))))..))))))))).)))))))))).)))).)))))))........

Structure
--aauguu       u    -          c     ca    uu    ----      uuu 
        ugggaau ggag aguaggaaag uuagc  ucua  cccu    ucaugg   c
        ||||||| |||| |||||||||| |||||  ||||  ||||    ||||||    
        auCCUUA CCUC UCAUCCUUUC gaucg  agau  gggg    gguacc   c
cuuuuguu       C    C          U     --    cu    guua      ucu 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr17: 5523024-5523140 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from vvi-MIR482
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR482

Accession MIMAT0006576
Description Vitis vinifera vvi-miR482 mature miRNA
Sequence 86 - UCUUUCCUACUCCUCCCAUUCC - 107
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558