miRBase entry: cfa-mir-132

Stem-loop cfa-mir-132


Accession
MI0008156
Description
Canis familiaris cfa-mir-132 precursor miRNA


Sequence


aaccguggcuuucgauuguuacugugggaaccggaggUAACAGUCUACAGCCAUGGUCGC
.(((((((((...((((((((((.(((...)))..))))))))))...)))))))))...

Structure
--a         uuc          -g   g 
   accguggcu   gauuguuacu  ugg  
   |||||||||   ||||||||||  ||| a
   UGGUACCGA   CUGACAAUgg  gcc  
CGC         CAU          ag   a 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr9: 46153531-46153590 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from cfa-mir-132
Name Accession Chromosome Start End Strand Confidence




Database links

Mature cfa-miR-132

Accession MIMAT0006732
Description Canis familiaris cfa-miR-132 mature miRNA
Sequence 38 - UAACAGUCUACAGCCAUGGUCGC - 60
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 18392026
    Discovering microRNAs from deep sequencing data using miRDeep
    "Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N"
    "Nat Biotechnol (2008) 26:407-415