miRBase entry: ssc-mir-16-1

Stem-loop ssc-mir-16-1


Accession
MI0008213
Description
Sus scrofa ssc-mir-16-1 precursor miRNA

Literature search
22 open access papers mention ssc-mir-16-1
(47 sentences)

Sequence

625 reads, 184 reads per million, 11 experiments
uccgcucUAGCAGCACGUAAAUAUUGGCGuaguaaaauaaauauuaaacaccaauauuauugugcugcuuuagcgug
..((((..(((((((((..((((((((.((((((.......))))..)).))))))))..)))))))))..))))..

Structure
uc    cU         UA        C  --    aa 
  cgcu  AGCAGCACG  AAUAUUGG Gu  agua  a
  ||||  |||||||||  |||||||| ||  ||||  u
  gcga  ucgucgugu  uuauaacc ca  uuau  a
gu    uu         ua        a  aa    aa 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr13: 108388290-108388366 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from ssc-mir-16-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ssc-miR-16

Accession MIMAT0007754
Description Sus scrofa ssc-miR-16 mature miRNA
Sequence 8 - UAGCAGCACGUAAAUAUUGGCG - 29
Evidence experimental
cloned [1,3], Illumina [2,4-5]

References

  1. PubMed ID: 19917043
    MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing
    "Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B"
    "Anim Genet (2010) 41:159-168

  2. PubMed ID: 20180025
    Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue
    "Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS"
    "Mol Biol Rep (2010) 37:3567-3574

  3. PubMed ID: 18548309
    Identification and characterization of new microRNAs from pig
    "Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS"
    "Mamm Genome (2008) 19:570-580

  4. PubMed ID: 21312241
    MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing
    "Li G, Li Y, Li X, Ning X, Li M, Yang G"
    "J Cell Biochem (2011) 112:1318-1328

  5. PubMed ID: 24499489
    Exploration of microRNAs in porcine milk exosomes
    Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL
    BMC Genomics (2014) 15:100