miRBase entry: hsa-mir-1908

Stem-loop hsa-mir-1908


Accession
MI0008329
Symbol
HGNC: MIR1908
Description
Homo sapiens hsa-mir-1908 precursor miRNA mir-1908
Gene
family?
RF03314; mir-1908

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1908 is a micro-RNA encoded by the MIR1908 gene located on chromosome 11 and is implicated in various biological processes and diseases [PMC9469614]. It has been identified as a potential biomarker for prostate cancer, with lower expression in tumor tissues compared to normal tissues, suggesting a role as a proliferation suppressor [PMC5696163]. MIR1908 has been associated with the activation of the AKT pathway in neuronal models, although this relationship was not observed in HuH-7 liver cancer cells [PMC8660805]. Additionally, MIR1908 expression appears to be regulated independently of the FADS1/2 loci despite their genomic proximity [PMC8660805]. The gene has also been linked to bipolar disorder (BD), with significant associations found after correction for multiple testing [PMC9547016]. Functional analyses have suggested that certain genetic variants within MIR1908 may alter its secondary structure and potentially its function [PMC9547016]. Despite these associations, further research is needed to fully understand the biological mechanisms and clinical significance of MIR1908.

Literature search
19 open access papers mention hsa-mir-1908
(146 sentences)

Sequence

492 reads, 19 reads per million, 70 experiments
cgggaaugccgCGGCGGGGACGGCGAUUGGUCcguauguguggugccaCCGGCCGCCGGCUCCGCCCCGgcccccgcccc
((((...((((.(((((((.(((((.(((((..((((.....)))).))))).))))).))))))).)))).))))....

Structure
----    aau    C       A     A     Cc    g 
    cggg   gccg GGCGGGG CGGCG UUGGU  guau u
    ||||   |||| ||||||| ||||| |||||  |||| g
    gccc   cgGC CCGCCUC GCCGC GGCCa  cgug u
cccc    --c    C       G     C     -c    g 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr11: 61815161-61815240 [-]

Disease association
hsa-mir-1908 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1908-5p

Accession MIMAT0007881
Description Homo sapiens hsa-miR-1908-5p mature miRNA
Sequence 12 - CGGCGGGGACGGCGAUUGGUC - 32
Evidence experimental
454 [1-2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-1908-3p

Accession MIMAT0026916
Description Homo sapiens hsa-miR-1908-3p mature miRNA
Sequence 49 - CCGGCCGCCGGCUCCGCCCCG - 69
Evidence experimental
Illumina [4]

References

  1. PubMed ID: 19508715
    Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing
    Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Møller S, Krogh A, Litman T
    BMC Med Genomics (2009) 2:35

  2. PubMed ID: 18583537
    MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries
    "Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M"
    "Stem Cells (2008) 26:2496-2505

  3. PubMed ID: 20224791
    Discovery of novel microRNAs in female reproductive tract using next generation sequencing
    Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH
    PLoS One (2010) 5:e9637

  4. PubMed ID: 23226537
    The repertoire and features of human platelet microRNAs
    Plé H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P
    PLoS One (2012) 7:e50746