miRBase entry: tca-mir-275

Stem-loop tca-mir-275


Accession
MI0008921
Description
Tribolium castaneum tca-mir-275 precursor miRNA


Sequence


gcuacgCGUGUUACCUCAGUACCUAGGCUGGgguuuuucgaaagUCAGGUACCUGAAGUAGCGCGCGcagc
(((.((((((((((.(((((((((.((((..((....))...))))))))).)))).)))))))))).)))

Structure
   a          C    -     A    -GG  u 
gcu cgCGUGUUAC UCAG UACCU GGCU   gg u
||| |||||||||| |||| ||||| ||||   ||  
cga GCGCGCGAUG AGUC AUGGA CUga   cu u
   c          A    C     -    aag  u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
ChLG9: 10587608-10587678 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from tca-mir-275
Name Accession Chromosome Start End Strand Confidence




Database links

Mature tca-miR-275-3p

Accession MIMAT0008379
Description Tribolium castaneum tca-miR-275-3p mature miRNA
Sequence 45 - UCAGGUACCUGAAGUAGCGCGCG - 67
Evidence experimental
SOLID [2]
Database links

Mature tca-miR-275-5p

Accession MIMAT0019123
Description Tribolium castaneum tca-miR-275-5p mature miRNA
Sequence 7 - CGUGUUACCUCAGUACCUAGGCUGG - 31
Evidence experimental
SOLID [2]
Database links

References

  1. PubMed ID: 18651924
    In silico prediction and characterization of microRNAs from red flour beetle (Tribolium castaneum)
    "Singh J, Nagaraju J"
    "Insect Mol Biol (2008) 17:427-436

  2. PubMed ID: 20817720
    Functional shifts in insect microRNA evolution
    "Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S"
    "Genome Biol Evol (2010) 2:686-696