miRBase entry: bta-mir-196b

Stem-loop bta-mir-196b


Accession
MI0009768
Description
Bos taurus bta-mir-196b precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. Bta-mir-196b is a differentially expressed microRNA identified as under-expressed in a comparative study, with a decreased fold-change of 3.66 [PMC7312616]. This miRNA is expressed at higher levels in Wagyu cattle compared to Holstein, suggesting its involvement in fat deposition regulation, potentially through the PPAR pathway which is known to influence adipocyte differentiation [PMC5341059]. Bta-mir-196b has been shown to regulate key transcription factors of the PPAR signaling pathway, namely PPARα, and is implicated in the regulation of various metabolic processes including lipid and glycerophospholipid metabolism as well as glucose metabolism by targeting genes associated with these pathways [PMC5341059]. It also has been associated with the inhibition of enzymes involved in triglyceride synthesis and degradation [PMC5341059]. The up-regulation of bta-mir-196b may influence fat deposition by affecting signal translation within the PPAR pathway through its target genes [PMC5341059]. Additionally, bta-mir-196b plays a role beyond metabolism; it has been implicated in host responses to infections such as its involvement in endothelial cell proliferation during Mycobacterium avium subspecies paratuberculosis infection [PMC6162677].

Literature search
14 open access papers mention bta-mir-196b
(43 sentences)

Sequence

8531 reads, 120 reads per million, 45 experiments
aacuggucggugauuUAGGUAGUUUCCUGUUGUUGGGAuccaccuuucucucgacagcacgacacugccuucauuacuucaguug
((((((..((((((..(((((((.((.(((((((((((..........))))))))))).)).)))))))..)))))))))))).

Structure
-      uc      uU       U  C           ucca 
 aacugg  ggugau  AGGUAGU UC UGUUGUUGGGA    c
 ||||||  ||||||  ||||||| || |||||||||||     
 uugacu  ucauua  uccguca ag acgacagcucu    c
g      --      cu       c  c           cuuu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr4: 69566921-69567005 [+]

Database links

Mature bta-miR-196b

Accession MIMAT0009256
Description Bos taurus bta-miR-196b mature miRNA
Sequence 16 - UAGGUAGUUUCCUGUUGUUGGGA - 38
Evidence not_experimental

References

  1. PubMed ID: 18215311
    miRNAminer: a tool for homologous microRNA gene search
    "Artzi S, Kiezun A, Shomron N"
    "BMC Bioinformatics (2008) 9:39

  2. PubMed ID: 18945293
    Annotation of 390 bovine miRNA genes by sequence similarity with other species
    "Strozzi F, Mazza R, Malinverni R, Williams JL"
    "Anim Genet (2009) 40:125