WARNING: This summary was generated by AI. Bta-mir-196b is a differentially expressed microRNA identified as under-expressed in a comparative study, with a decreased fold-change of 3.66 [PMC7312616]. This miRNA is expressed at higher levels in Wagyu cattle compared to Holstein, suggesting its involvement in fat deposition regulation, potentially through the PPAR pathway which is known to influence adipocyte differentiation [PMC5341059]. Bta-mir-196b has been shown to regulate key transcription factors of the PPAR signaling pathway, namely PPARα, and is implicated in the regulation of various metabolic processes including lipid and glycerophospholipid metabolism as well as glucose metabolism by targeting genes associated with these pathways [PMC5341059]. It also has been associated with the inhibition of enzymes involved in triglyceride synthesis and degradation [PMC5341059]. The up-regulation of bta-mir-196b may influence fat deposition by affecting signal translation within the PPAR pathway through its target genes [PMC5341059]. Additionally, bta-mir-196b plays a role beyond metabolism; it has been implicated in host responses to infections such as its involvement in endothelial cell proliferation during Mycobacterium avium subspecies paratuberculosis infection [PMC6162677].
- uc uU U C ucca aacugg ggugau AGGUAGU UC UGUUGUUGGGA c |||||| |||||| ||||||| || ||||||||||| uugacu ucauua uccguca ag acgacagcucu c g -- cu c c cuuu
| Accession | MIMAT0009256 |
| Description | Bos taurus bta-miR-196b mature miRNA |
| Sequence | 16 - UAGGUAGUUUCCUGUUGUUGGGA - 38 |
| Evidence | not_experimental |
|