Stem-loop osa-MIR2118o

Accession

MI0011265

Description

Oryza sativa osa-MIR2118o precursor miRNA

Literature search

29 open access papers mention osa-MIR2118o
(169 sentences)

Sequence

5 reads, 3 reads per million, 2 experiments

ggaagaggaagaaaagagggccaaggagcagugggcauggggacaugaaggaaugcuuaagccccucuccaauccucgcaugagauuggagauggaguuaugaguuCUCCUGAUGCCUCCCAAGCCUAuuguuccuuggugcuccuuccucuucc
(((((((((((....(((.(((((((((((((((((.(((((.(((..((((..((((((((((.(((((((((.((....))))))))))).)).))).)))))..)))).))).).)))).))))))))))))))))).))))))))))))))

Structure

           aaaa   g                 a    - a   ga    au     -   -  c         c  g 
ggaagaggaag    gag gccaaggagcagugggc uggg g cau  agga  gcuua agc cc ucuccaauc uc c
|||||||||||    ||| ||||||||||||||||| |||| | |||  ||||  ||||| ||| || ||||||||| ||  
ccuucuccuuc    cuc ugguuccuuguuAUCCG ACCC C GUA  UCCU  ugagu uug gg agagguuag ag a
           ----   g                 A    U C   -G    Cu     a   a  u         -  u 

Annotation confidence Not enough data

Genome context

Chr4: 21661272-21661426 [-]

Clustered miRNAs

7 other miRNAs are < 10 kb from osa-MIR2118o

Mature osa-miR2118o

• Accession: MIMAT0011754
• Description: Oryza sativa osa-miR2118o mature miRNA
• Sequence: 107 - CUCCUGAUGCCUCCCAAGCCUA - 128
• Evidence: experimental ; 454 [1]

References

1. PubMed ID: 19584097
   Clusters and superclusters of phased small RNAs in the developing inflorescence of rice
   "Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH"
   "Genome Res (2009) 19:1429-1440